Phenotypic Mutation 'toku' (pdf version)
Alleletoku
Mutation Type frame shift
Chromosome9
Coordinate96,140,629 bp (GRCm38)
Base Change GCC ⇒ GC (forward strand)
Gene Gk5
Gene Name glycerol kinase 5 (putative)
Synonym(s) C330018K18Rik, G630067D24Rik
Chromosomal Location 96,119,362-96,184,608 bp (+)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Accession Number

Ncbi Refseq: NM_177352.4; MGI: 2443336

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000082313 ] [ENSMUSP00000112717 ] [ENSMUSP00000123594]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Predicted Effect probably benign
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS central memory CD8 T cells in CD8 T cells - increased
skin/coat/nails 28607088
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Candidate Explorer Status CE: excellent candidate; human score: 0; ML prob: 0.5252
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96137789 missense probably damaging 0.98
IGL01387:Gk5 APN 9 96177554 critical splice donor site probably null
IGL01771:Gk5 APN 9 96177435 missense probably damaging 0.97
IGL02253:Gk5 APN 9 96137771 missense probably damaging 1.00
IGL02380:Gk5 APN 9 96150480 missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96129046 missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96176292 splice site probably benign
IGL03256:Gk5 APN 9 96129053 missense probably damaging 1.00
IGL03326:Gk5 APN 9 96137839 critical splice donor site probably null
barrener UTSW 9 96129096 critical splice donor site probably null
glimpse UTSW 9 96181770 critical splice acceptor site probably null
homer UTSW 9 96140656 nonsense probably null
sean UTSW 9 96176237 nonsense probably null
stripped UTSW 9 96129053 missense probably damaging 1.00
tangyuan UTSW 9 96150797 critical splice donor site probably null
I1329:Gk5 UTSW 9 96140629 frame shift probably null
R0279:Gk5 UTSW 9 96174804 splice site probably benign
R0284:Gk5 UTSW 9 96181770 critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96133407 missense probably benign 0.00
R1184:Gk5 UTSW 9 96150420 splice site probably benign
R1772:Gk5 UTSW 9 96150797 critical splice donor site probably null
R1781:Gk5 UTSW 9 96133455 missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96129096 critical splice donor site probably null
R4213:Gk5 UTSW 9 96129053 missense probably damaging 1.00
R5015:Gk5 UTSW 9 96177417 critical splice acceptor site probably null
R5166:Gk5 UTSW 9 96174768 missense probably damaging 0.99
R5643:Gk5 UTSW 9 96140656 nonsense probably null
R5857:Gk5 UTSW 9 96119455 nonsense probably null
R5924:Gk5 UTSW 9 96150510 critical splice donor site probably null
R6109:Gk5 UTSW 9 96140610 missense probably benign 0.00
R6138:Gk5 UTSW 9 96176237 nonsense probably null
R6725:Gk5 UTSW 9 96155470 missense probably benign 0.01
R6812:Gk5 UTSW 9 96150749 missense probably damaging 0.99
R7065:Gk5 UTSW 9 96179056 missense probably damaging 1.00
R7182:Gk5 UTSW 9 96119526 missense possibly damaging 0.89
R7213:Gk5 UTSW 9 96145712 missense probably damaging 1.00
R7260:Gk5 UTSW 9 96119610 missense probably benign 0.10
R7666:Gk5 UTSW 9 96153107 missense probably damaging 1.00
U15987:Gk5 UTSW 9 96176237 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
Repository

MMRRC:37473

Last Updated 2019-08-15 3:05 PM by External Program
Record Created 2011-02-22 10:20 PM by Wataru Tomisato
Record Posted 2017-05-25
Other Mutations in This Stock Stock #: I1329 Run Code: HSQ01003
Coding Region Coverage: 10x: 96.9% 20x: 95.2%
Validation Efficiency: 42/47

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
4931406P16Rik A to G 7: 34,245,194 S542P probably benign Het
Adamts13 T to C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T to A 4: 110,478,455 probably benign Het
Aspscr1 G to C 11: 120,701,240 V268L probably damaging Het
Btbd10 A to G 7: 113,332,875 S115P probably benign Het
Cercam T to A 2: 29,871,085 V132E probably damaging Het
Decr1 G to A 4: 15,930,976 R119* probably null Het
Dlst T to C 12: 85,123,841 M248T probably damaging Het
Erbb3 T to C 10: 128,583,454 N215S possibly damaging Het
Flnc G to A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC to GC 9: 96,140,629 probably null Het
Glrb T to A 3: 80,862,074 R115S probably damaging Het
Gm5592 T to A 7: 41,286,354 Y93* probably null Het
Gpr20 C to T 15: 73,695,763 R259H probably damaging Het
Il1rap A to G 16: 26,692,850 T215A probably benign Het
Ipmk T to C 10: 71,381,447 C275R possibly damaging Het
Lats1 A to G 10: 7,712,802 N1061S probably benign Het
Nkain3 A to G 4: 20,158,329 probably benign Het
Nr1h4 A to G 10: 89,483,362 probably benign Het
Nr4a3 A to G 4: 48,051,585 Q142R probably benign Het
Otog G to A 7: 46,246,503 V131I probably benign Het
Parp12 A to T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A to G 14: 93,886,209 S842P probably benign Het
Phc2 G to C 4: 128,711,113 G214A probably damaging Het
Prpf40a C to A 2: 53,176,395 V92L probably benign Het
Qser1 A to T 2: 104,786,977 Y1163* probably null Het
Rpe65 A to G 3: 159,624,723 D509G probably benign Het
Scin T to A 12: 40,073,330 N518I probably damaging Het
Sfswap G to T 5: 129,507,137 probably benign Het
Tfpi A to T 2: 84,444,116 N182K possibly damaging Het
Tph1 A to G 7: 46,650,013 L368P probably damaging Het
Ttn T to C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G to A 2: 120,934,294 probably benign Het
Usf3 G to T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T to G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C to A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A to G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A to G 2: 165,828,225 F488S probably damaging Het
Phenotypic Description
Figure 1. The toku phenotype. (A) Representative adult homozygote toku mouse exhibiting alopecia. (B) Delayed hair growth in a representative toku homozygote (top right) at postnatal day (P) 10; a littermate wild-type mouse is shown at the bottom left.

The toku phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized mice as a secondary phenotype of the Kokuten mice (I1329). Toku homozygous mice exhibited alopecia (Figure 1A). Homozygous toku mice exhibited delayed eruption of hair from the skin surface (Figure 1B).

Nature of Mutation
Figure 2. The toku phenotype was mapped by bulk segregation analysis to a 57.4 Mbp critical region on mouse chromosome 9.
Figure 3. DNA sequence chromatogram of the deleted nucleotide in Gk5.
Figure 4. The phenotype of three Gk5-TALEN founders.

The toku mutation was mapped to a 57.4 Mbp region of chromosome 9 by bulk segregation analysis (Figure 2).  Sanger sequencing identified a deletion of a cytosine (C) at base pair 96,140,631 (NCBI v38) on chromosome 9, within exon 5 (of 16 total exons) of Gk5 (Figure 3), which corresponds to position 519 of the Gk5 cDNA transcript (ENSMUST00000085217).

C57BL/6J:

               <--Exon 5-->

507 ...CACCCAGCATGCCACCTTAAGATTGACCTGGATTTTA...  

170 ...--T--Q--H--A--T--L--R--L--T--W--I--L-...


 
toku:

       <--Exon 5-->

507 ...CACCCAGCATGCACCTTAAGATTGACCTGGATTTTA...  

170 ...--T--Q--H--A--P--*-

 

The deleted C is in red in the C57BL/6J sequence above. The toku transcript codes a premature stop codon after amino acid 174.

 

TALEN-mediated targeting of Gk5 confirmed that the causative mutation for the alopecia phenotype was in Gk5 (Figure 4).

Protein Prediction
Figure 5. Domain organization of GK5. The location of the toku mutation is indicated. Additional mutations in GK5 are noted. Click on each mutation to view more information.
Figure 6. Crystal structure of E. coli GK in complex with IIAGlc. Figure is adapted from PDB:1GLB. Figure was generated by UCSF Chimera.

Gk5 gene encodes the 534 amino acid (aa) glycerol kinase 5 (GK5) protein. Although the protein domains of GK5 have not been documented, SMART predicts that GK5 contains two domains that are found in the FGGY family of carbohydrate kinases (Figure 5), which also includes glycerol kinase (Gyk; alternatively, GK (in humans); it will be referred to as GK for clarity), glucokinase (Gck), xylulokinase (Xylb), and Hsc70 (or Hspa8). The FGGY kinases contain conserved motifs at both the N- and C-termini (amino acids 25-287 and aa 396-416 in mouse GK5, respectively; SMART). The FGGY_N and FGGY_C termini are structurally similar and adopt a ribonuclease H-like fold (2;3). Between the FGGY_N and FGGY_C domains is a catalytic cleft where a sugar substrate and ATP bind (4). The substrate interacts mainly with the N-terminus; ATP contacts both the N- and C-terminal domains (4). Upon binding of the substrate (e.g., glycerol), a conformational change occurs whereby the N- and C-termini close to prevent any solvents from entering the catalytic cleft [(5-8); reviewed in (2;4)]. A highly conserved 29-aa extension at the C-terminus of GK is proposed to mediate the binding of GK to the voltage-dependent anion channel (VDAC) at the mitochondrial outer membrane (9); the function of the C-terminus of GK5 has not been elucidated.

 

The FGGY proteins have five specificity-determining positions (SDPs) within the catalytic cleft (4). The side chains of the amino acids at the SDPs point toward the center of the substrate binding site, interacting with the substrates (4). In addition to the SDPs, other amino acids have been identified to be essential for the function of GK. For example, Asp10 and Asp245 (both in in E. coli) are proposed to contribute to a Mg2+-binding site that may function in GK-mediated ATP hydrolysis based on the structures of hexokinase, HSC70, and actin [(10); reviewed in (2)]. Hurley et al. also determined that Asp245 (in E. coli) forms a hydrogen bond with the 3-hydroxyl of glycerol, indicating that it is the catalytic base in the phosphorylation reaction (2)

 

The crystal structure of E. coli GK in complex with IIAGlc (or IIIGlc) has been solved [Figure 6; PDB: 1GLB; (2)]. IIAGlc is a member of the phosphoenolpyruvate:glucose phosphotransferase system in bacteria that is responsible for the uptake and phosphorylation of glucose. GK forms functional dimers and tetramers [(11-13); reviewed in (2)]. The FGGY domains (denoted here as domains I and II) are subdivided: IA (aa 1-35, 49-83, 165-173, and 221-253), IIA (aa 254-306 and 373-472), IB (aa 36-48 and 82-164), IC (aa 174-220), IIB (aa 307-372), and IIC (aa 456-501)). Domains IB, IC, IIB, and IIC are insertions into, or extensions of, the ATPase core in hexokinase (14), HSC70 (10;15), and actin (16); subdomains IC and IIC are unique to GK (2). Also unique from other FGGY family members is that the IB subdomain of GK contains two insertions, making it larger than other IB sub-domains; it contains a central five-stranded antiparallel β-sheet (2). Sub-domain IIB is topologically identical to those found in HSC70 and actin (2).

Expression/Localization
Figure 7. GK5 is predominantly expressed in the sebaceous glands of the skin. Lysates from skin, liver, white adipose tissue (WAT), muscle, lung, spleen, kidney, heart, pancreas, salivary gland, thymus, and brain from wild-type and toku homozygotes were immunoblotted using the indicated antibodies.
Figure 8. GK5 is predominantly expressed in the sebaceous glands of the skin. (C) Immunohistochemical staining of postnatal day 56 (P56) skin sections shows that GK5 is expressed mainly in the sebaceous glands in wild-type mouse skin; GK5 was not detected in the toku skin. Images were captured at 200X magnification. (D) FLAG-tagged GK5-v2 localized mainly in the cytoplasm in transfected NIH-3T3 cells. Immunofluorescence was performed using the FLAG antibody. DAPI stained the nuclei of the cells. All the experiments were repeated at least three times and a representative experiment was shown.

Gk5 has three isoforms, the canonical 2,823 bp transcript (ENSMUST00000085217) that encodes the 534 amino acid protein, a 4,474 bp transcript (ENSMUST00000122383) that encodes a 516 amino acid protein product, and a third 2,506 bp isoform (ENSMUST00000129774) that encodes a 59 amino acid polypeptide; the 59 aa product is expected to undergo nonsense-mediated decay (Ensembl). A fourth transcript, ENSMUST00000136496, does not encode a protein product. The 516 amino acid protein product of isoform two differs from the canonical 534 amino acid sequence at the C-terminus (Uniprot: Q8BX05). 

 

Gk5 is expressed in several mouse tissues; however, protein expression was observed solely in the skin (Figure 7) (1). GK5 is localized to the sebaceous glands adjacent to the hair follicles and it is cytoplasmic (Figure 8).

Background

Figure 9. GK5 regulates the processing and nuclear translocation of SREBP-1 and SREBP-2 in the skin. When sufficient sterols are present in the cell, via interactions between the C-terminal regulatory domain (Reg) on SREBPs and WD motifs on SCAP, the SREBPs form a complex with SCAP and remain in the ER.  Retntion in the ER depends on interaction between the sterol-sensing domain (SSD) of SCAP and either Insig-1 or -2.  The SCAP-Insig-1 interaction is strongly enhanced by cholesterol, while the SCAP-Insig-2 interaction absolutely requires cholesterol.  In the absense of sterols, SCAP and Insig do not interact, and SCAP is freed to transport SREBPs to the Golgi via COPII vesicles.  There, sequential cleavage of SREPBs by S1P and S2P (red lines), releases the basic helix-loop-helix-leucine-zipper transcription factor for translocation to the nucleus and activation of target genes.  

The members of the FGGY family phosphorylate sugar substrates in an ATP-dependent manner (4). GK mediates an ATP-dependent glycerol phosphorylation to G3P, an important precursor protein in glucose and lipid metabolism (17). G3P is essential for the production of glycerides, glucose, glycogen, and dihydroxyacetone phosphate (DHAP), an intermediate in several metabolic pathways (e.g. glycolysis and glycogenesis) (18-20). G3P is also involved in cancer development and is a substrate in acylglycerol synthesis, a process involved in the energy shuttle system of the mitochondria that provides energy to the cell during cell proliferation and development (21). After GK-mediated phosphorylation of glycerol to G3P, approximately 70-90% of the G3P is oxidized via G3P dehydrogensase to dihydroxyacetone phosphate, which can enter the Embden-Meyerhof pathway (i.e. glycolysis) [reviewed in (22)]. The remainder combines with free fatty acids to form triglycerides [(23); reviewed in (22)]. In non-hepatic tissues that lack significant GK activity, glycerol returns to the liver to be phosphorylated (24). In the liver, the glycerol can then be reesterified to triglyceride; the remainder will enter the glycolytic/gluconeogenic metabolite pool (24). In the glycolytic pathway, the glycerol will result in the conversion of pyruvate to lactate or acetyl CoA; in the gluconeogenic pathway, there is an eventual release of glucose or a storage of glycogen (19;24)

 

GK5 exhibits glycerol kinase activity albeit at significantly lower rates than GK (1). GK5 functions specifically in the skin to regulate SREBP-1/-2-mediated free cholesterol, cholesteryl esters, triglycerides, and ceramides production. In the skin, GK5 specifically functions in regulating the processing of the SREBPs, which promote cholesterol biosynthesis and homeostasis by stimulating the transcription of sterol-regulated genes (e.g., Hmgcr, Hmgcs1, Hmgcs2, Acaca, Fasn, Scd1, Ldlr, and Fdps) (1).

 

GK5 is one of several transcripts that are upregulated in patients that have received intestinal transplant grafts and that experience early acute cellular rejection (25).

Putative Mechanism
Figure 10. GK5 deficiency promotes SREBP processing and increases the nuclear-localized transcriptionally active forms. Immunoblot analysis of SREBP-1, SREBP-2, and their target HMGCR in the skin and liver of homozygous toku and wild-type mice. GAPDH is shown as the loading control.
Figure 11. Alopecia phenotype of toku mice is corrected by simvastatin treatment. (A) Wild-type and toku homozygotes were treated with either vehicle only or vehicle plus simvastatin from P2 to P14. Images were captured at P90. Representative images are shown.

The levels of the transcriptionally active forms of SREBP-1 and SREBP-2 were increased in the skin of the toku mice (Figure 10). The expression level of HMGCR, a SREBP-1/-2 target, was increased in the toku skin compared to that in wild-type skin (Figure 10). Treatment of the toku mice with simvastatin, a statin inhibitor of HMGCR, the rate-determining cholesterol biosynthesis enzyme, showed that blockade of the levels of sterol precursors or cholesterol in the skin could rescue the hair loss phenotype (Figure 11). Together, these findings indicate that increased sterol precursors and/or cholesterol in the skin caused the hair loss in Gk5-deficient mice (1).

Primers
Genotyping

Toku genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification:

 

Primers for PCR amplification

Toku (F): 5'- TTCAGAAGGTTGAGAGCCACCACG -3'

Toku (R): 5'- CATGCCTGAGTCACCCAAAATGTTG -3'

 

Primers for Sequencing

Toku_seq (F): 5'- GGTGCTTTAACTGAACCCAGG -3'

Toku_seq (R): 5'- CTCATCGTTAGACATCGTTAGAGC -3'

 

PCR program

1) 94° C      2:00

2) 94° C      0:30

3) 60° C      0:30

4) 72° C      1:00

5) repeat steps (2-4) 29x

6) 72° C      7:00

7) 4° C        

 

The following sequence of 751 nucleotides (from Genbank genomic region: NC_000075.6 of the linear genomic sequence of Gk5) is amplified:

20790                                t tcagaaggtt gagagccacc acgtgggtgc
20821 tttaactgaa cccaggggct ctgcaagagc agcaagtgtt cttaatcact gagatgcctc
20881 tctaacctct gtttttgttc tgtaagaaac ggattaagct ggacatagtg gtgcacatca
20941 ttaatcctag tgtgggggaa gcagaaacag gtggacctga actccataag ttcaatgcca
21001 gccaggacta catagttata ccctgtcttg aaaaggggag ggggtcgaga aagaaaaccc
21061 aagtgccctt aaatgtattt ccttaaagat ctcttttgtt tttaaaacag ctattgcatg
21121 gggccacccg agtccttcat ttcttcagta gaagtaaagt aatgctaacg gtcagccgct
21181 tcaatttcag cacccagcat gccaccttaa gattgacctg gattttacaa aacctatctg
21241 aggtaagaga agattgtgtg tgtggagagg ggatcatgac tgtggggaag aaaaatttaa
21301 agagtaagaa caataatcca gccttttggg gaagtgacca gtactcctgg gctagaagac
21361 agagttttca attggttcct gtgtttaaag tctttgtgtt atgtcataac acaaaaaaga
21421 ttgacagtaa gtttgaagct aacctgggct acatccagga gctctaacga tgtctaacga
21481 tgagatgaca ttcttatgta tgctagatag gtacccaaca ttttgggtga ctcaggcatg

 

PCR primer binding sites are underlined; Sequencing primer binding sites are highlighted; the deleted C is highlighted in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsDuanwu Zhang, Wataru Tomisato, Bruce Beutler