Phenotypic Mutation 'toku'

• Allele: toku
• Mutation Type: frame shift
• Chromosome: 9
• Coordinate: 96,022,682 bp (GRCm39)
• Base Change: GCC ⇒ GC (forward strand)
• Gene: Gk5
• Gene Name: glycerol kinase 5
• Synonym(s): G630067D24Rik, C330018K18Rik
• Chromosomal Location: 96,001,415-96,066,661 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000082313 ^†] [ENSMUSP00000112717 ^†] [ENSMUSP00000123594 ^†] † probably from a misspliced transcript
• AlphaFold: Q8BX05
• SMART Domains: Protein: ENSMUSP00000082313; Gene: ENSMUSG00000041440

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
Pfam:FGGY_N	25	287	9e-50	PFAM
Pfam:FGGY_C	296	485	7.7e-35	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000112717; Gene: ENSMUSG00000041440

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
Pfam:FGGY_N	25	287	1.9e-49	PFAM
Pfam:FGGY_C	296	485	1.8e-35	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123594; Gene: ENSMUSG00000041440

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
SCOP:d1bu6o1	24	56	1e-5	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2011-02-22 10:20 PM by Wataru Tomisato
• Record Posted: 2017-05-25
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Duanwu Zhang, Wataru Tomisato, Bruce Beutler

Accession Number

Ncbi Refseq: NM_177352.4; MGI: 2443336

Alleles Listed at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Repository

MMRRC:37473

Phenotypic Description

Figure 1. The toku phenotype. ( A ) Representative adult homozygote toku mouse exhibiting alopecia. ( B ) Delayed hair growth in a representative toku homozygote (top right) at postnatal day (P) 10; a littermate wild-type mouse is shown at the bottom left.

The toku phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized mice as a secondary phenotype of the Kokuten mice (I1329). Toku homozygous mice exhibited alopecia (Figure 1A). Homozygous toku mice exhibited delayed eruption of hair from the skin surface (Figure 1B).

Nature of Mutation

Figure 2. The toku phenotype was mapped by bulk segregation analysis to a 57.4 Mbp critical region on mouse chromosome 9.

Figure 3. DNA sequence chromatogram of the deleted nucleotide in Gk5 .

Figure 4. The phenotype of three Gk5 -TALEN founders.

The toku mutation was mapped to a 57.4 Mbp region of chromosome 9 by bulk segregation analysis (Figure 2).  Sanger sequencing identified a deletion of a cytosine (C) at base pair 96,140,631 (NCBI v38) on chromosome 9, within exon 5 (of 16 total exons) of Gk5 (Figure 3), which corresponds to position 519 of the Gk5 cDNA transcript (ENSMUST00000085217).

C57BL/6J:                <--Exon 5--> 507 ...CACCCAGCATGCCACCTTAAGATTGACCTGGATTTTA...   170 ...--T--Q--H--A--T--L--R--L--T--W--I--L-...   toku:        <--Exon 5--> 507 ...CACCCAGCATGCACCTTAAGATTGACCTGGATTTTA...   170 ...--T--Q--H--A--P--*-

The deleted C is in red in the C57BL/6J sequence above. The toku transcript codes a premature stop codon after amino acid 174.

TALEN-mediated targeting of Gk5 confirmed that the causative mutation for the alopecia phenotype was in Gk5 (Figure 4).

Protein Prediction

Figure 5. Domain organization of GK5. The location of the toku mutation is indicated. Additional mutations in GK5 are noted. Click on each mutation to view more information.

Figure 6. Crystal structure of E. coli GK in complex with IIA^Glc. Figure is adapted from PDB:1GLB. Figure was generated by UCSF Chimera.

Gk5 gene encodes the 534 amino acid (aa) glycerol kinase 5 (GK5) protein. Although the protein domains of GK5 have not been documented, SMART predicts that GK5 contains two domains that are found in the FGGY family of carbohydrate kinases (Figure 5), which also includes glycerol kinase (Gyk; alternatively, GK (in humans); it will be referred to as GK for clarity), glucokinase (Gck), xylulokinase (Xylb), and Hsc70 (or Hspa8). The FGGY kinases contain conserved motifs at both the N- and C-termini (amino acids 25-287 and aa 396-416 in mouse GK5, respectively; SMART). The FGGY_N and FGGY_C termini are structurally similar and adopt a ribonuclease H-like fold (2;3). Between the FGGY_N and FGGY_C domains is a catalytic cleft where a sugar substrate and ATP bind (4). The substrate interacts mainly with the N-terminus; ATP contacts both the N- and C-terminal domains (4). Upon binding of the substrate (e.g., glycerol), a conformational change occurs whereby the N- and C-termini close to prevent any solvents from entering the catalytic cleft [(5-8); reviewed in (2;4)]. A highly conserved 29-aa extension at the C-terminus of GK is proposed to mediate the binding of GK to the voltage-dependent anion channel (VDAC) at the mitochondrial outer membrane (9); the function of the C-terminus of GK5 has not been elucidated.

The FGGY proteins have five specificity-determining positions (SDPs) within the catalytic cleft (4). The side chains of the amino acids at the SDPs point toward the center of the substrate binding site, interacting with the substrates (4). In addition to the SDPs, other amino acids have been identified to be essential for the function of GK. For example, Asp10 and Asp245 (both in in E. coli) are proposed to contribute to a Mg²⁺-binding site that may function in GK-mediated ATP hydrolysis based on the structures of hexokinase, HSC70, and actin [(10); reviewed in (2)]. Hurley et al. also determined that Asp245 (in E. coli) forms a hydrogen bond with the 3-hydroxyl of glycerol, indicating that it is the catalytic base in the phosphorylation reaction (2). 

The crystal structure of E. coli GK in complex with IIA^Glc (or III^Glc) has been solved [Figure 6; PDB: 1GLB; (2)]. IIA^Glc is a member of the phosphoenolpyruvate:glucose phosphotransferase system in bacteria that is responsible for the uptake and phosphorylation of glucose. GK forms functional dimers and tetramers [(11-13); reviewed in (2)]. The FGGY domains (denoted here as domains I and II) are subdivided: IA (aa 1-35, 49-83, 165-173, and 221-253), IIA (aa 254-306 and 373-472), IB (aa 36-48 and 82-164), IC (aa 174-220), IIB (aa 307-372), and IIC (aa 456-501)). Domains IB, IC, IIB, and IIC are insertions into, or extensions of, the ATPase core in hexokinase (14), HSC70 (10;15), and actin (16); subdomains IC and IIC are unique to GK (2). Also unique from other FGGY family members is that the IB subdomain of GK contains two insertions, making it larger than other IB sub-domains; it contains a central five-stranded antiparallel β-sheet (2). Sub-domain IIB is topologically identical to those found in HSC70 and actin (2).

Expression/Localization

Figure 7. GK5 is predominantly expressed in the sebaceous glands of the skin. Lysates from skin, liver, white adipose tissue (WAT), muscle, lung, spleen, kidney, heart, pancreas, salivary gland, thymus, and brain from wild-type and toku homozygotes were immunoblotted using the indicated antibodies.

Figure 8. GK5 is predominantly expressed in the sebaceous glands of the skin. (C) Immunohistochemical staining of postnatal day 56 (P56) skin sections shows that GK5 is expressed mainly in the sebaceous glands in wild-type mouse skin; GK5 was not detected in the toku skin. Images were captured at 200X magnification. (D) FLAG-tagged GK5-v2 localized mainly in the cytoplasm in transfected NIH-3T3 cells. Immunofluorescence was performed using the FLAG antibody. DAPI stained the nuclei of the cells. All the experiments were repeated at least three times and a representative experiment was shown.

Gk5 has three isoforms, the canonical 2,823 bp transcript (ENSMUST00000085217) that encodes the 534 amino acid protein, a 4,474 bp transcript (ENSMUST00000122383) that encodes a 516 amino acid protein product, and a third 2,506 bp isoform (ENSMUST00000129774) that encodes a 59 amino acid polypeptide; the 59 aa product is expected to undergo nonsense-mediated decay (Ensembl). A fourth transcript, ENSMUST00000136496, does not encode a protein product. The 516 amino acid protein product of isoform two differs from the canonical 534 amino acid sequence at the C-terminus (Uniprot: Q8BX05). 

Gk5 is expressed in several mouse tissues; however, protein expression was observed solely in the skin (Figure 7) (1). GK5 is localized to the sebaceous glands adjacent to the hair follicles and it is cytoplasmic (Figure 8).

Background

Figure 9. GK5 regulates the processing and nuclear translocation of SREBP-1 and SREBP-2 in the skin. When sufficient sterols are present in the cell, via interactions between the C-terminal regulatory domain (Reg) on SREBPs and WD motifs on SCAP, the SREBPs form a complex with SCAP and remain in the ER. Retntion in the ER depends on interaction between the sterol-sensing domain (SSD) of SCAP and either Insig-1 or -2. The SCAP-Insig-1 interaction is strongly enhanced by cholesterol, while the SCAP-Insig-2 interaction absolutely requires cholesterol. In the absense of sterols, SCAP and Insig do not interact, and SCAP is freed to transport SREBPs to the Golgi via COPII vesicles. There, sequential cleavage of SREPBs by S1P and S2P (red lines), releases the basic helix-loop-helix-leucine-zipper transcription factor for translocation to the nucleus and activation of target genes.

The members of the FGGY family phosphorylate sugar substrates in an ATP-dependent manner (4). GK mediates an ATP-dependent glycerol phosphorylation to G3P, an important precursor protein in glucose and lipid metabolism (17). G3P is essential for the production of glycerides, glucose, glycogen, and dihydroxyacetone phosphate (DHAP), an intermediate in several metabolic pathways (e.g. glycolysis and glycogenesis) (18-20). G3P is also involved in cancer development and is a substrate in acylglycerol synthesis, a process involved in the energy shuttle system of the mitochondria that provides energy to the cell during cell proliferation and development (21). After GK-mediated phosphorylation of glycerol to G3P, approximately 70-90% of the G3P is oxidized via G3P dehydrogensase to dihydroxyacetone phosphate, which can enter the Embden-Meyerhof pathway (i.e. glycolysis) [reviewed in (22)]. The remainder combines with free fatty acids to form triglycerides [(23); reviewed in (22)]. In non-hepatic tissues that lack significant GK activity, glycerol returns to the liver to be phosphorylated (24). In the liver, the glycerol can then be reesterified to triglyceride; the remainder will enter the glycolytic/gluconeogenic metabolite pool (24). In the glycolytic pathway, the glycerol will result in the conversion of pyruvate to lactate or acetyl CoA; in the gluconeogenic pathway, there is an eventual release of glucose or a storage of glycogen (19;24). 

GK5 exhibits glycerol kinase activity albeit at significantly lower rates than GK (1). GK5 functions specifically in the skin to regulate SREBP-1/-2-mediated free cholesterol, cholesteryl esters, triglycerides, and ceramides production. In the skin, GK5 specifically functions in regulating the processing of the SREBPs, which promote cholesterol biosynthesis and homeostasis by stimulating the transcription of sterol-regulated genes (e.g., Hmgcr, Hmgcs1, Hmgcs2, Acaca, Fasn, Scd1, Ldlr, and Fdps) (1).

GK5 is one of several transcripts that are upregulated in patients that have received intestinal transplant grafts and that experience early acute cellular rejection (25).

Putative Mechanism

Figure 10. GK5 deficiency promotes SREBP processing and increases the nuclear-localized transcriptionally active forms. Immunoblot analysis of SREBP-1, SREBP-2, and their target HMGCR in the skin and liver of homozygous toku and wild-type mice. GAPDH is shown as the loading control.

Figure 11. Alopecia phenotype of toku mice is corrected by simvastatin treatment. ( A ) Wild-type and toku homozygotes were treated with either vehicle only or vehicle plus simvastatin from P2 to P14. Images were captured at P90. Representative images are shown.

The levels of the transcriptionally active forms of SREBP-1 and SREBP-2 were increased in the skin of the toku mice (Figure 10). The expression level of HMGCR, a SREBP-1/-2 target, was increased in the toku skin compared to that in wild-type skin (Figure 10). Treatment of the toku mice with simvastatin, a statin inhibitor of HMGCR, the rate-determining cholesterol biosynthesis enzyme, showed that blockade of the levels of sterol precursors or cholesterol in the skin could rescue the hair loss phenotype (Figure 11). Together, these findings indicate that increased sterol precursors and/or cholesterol in the skin caused the hair loss in Gk5-deficient mice (1).

Genotyping

Toku genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification:

Primers for PCR amplification

Toku (F): 5'- TTCAGAAGGTTGAGAGCCACCACG -3'

Toku (R): 5'- CATGCCTGAGTCACCCAAAATGTTG -3'

Primers for Sequencing

Toku_seq (F): 5'- GGTGCTTTAACTGAACCCAGG -3'

Toku_seq (R): 5'- CTCATCGTTAGACATCGTTAGAGC -3'

PCR program

1) 94° C      2:00

2) 94° C      0:30

3) 60° C      0:30

4) 72° C      1:00

5) repeat steps (2-4) 29x

6) 72° C      7:00

7) 4° C         ∞

The following sequence of 751 nucleotides (from Genbank genomic region: NC_000075.6 of the linear genomic sequence of Gk5) is amplified:

20790                                t tcagaaggtt gagagccacc acgtgggtgc
20821 tttaactgaa cccaggggct ctgcaagagc agcaagtgtt cttaatcact gagatgcctc
20881 tctaacctct gtttttgttc tgtaagaaac ggattaagct ggacatagtg gtgcacatca
20941 ttaatcctag tgtgggggaa gcagaaacag gtggacctga actccataag ttcaatgcca
21001 gccaggacta catagttata ccctgtcttg aaaaggggag ggggtcgaga aagaaaaccc
21061 aagtgccctt aaatgtattt ccttaaagat ctcttttgtt tttaaaacag ctattgcatg
21121 gggccacccg agtccttcat ttcttcagta gaagtaaagt aatgctaacg gtcagccgct
21181 tcaatttcag cacccagcat gccaccttaa gattgacctg gattttacaa aacctatctg
21241 aggtaagaga agattgtgtg tgtggagagg ggatcatgac tgtggggaag aaaaatttaa
21301 agagtaagaa caataatcca gccttttggg gaagtgacca gtactcctgg gctagaagac
21361 agagttttca attggttcct gtgtttaaag tctttgtgtt atgtcataac acaaaaaaga
21421 ttgacagtaa gtttgaagct aacctgggct acatccagga gctctaacga tgtctaacga
21481 tgagatgaca ttcttatgta tgctagatag gtacccaaca ttttgggtga ctcaggcatg

PCR primer binding sites are underlined; Sequencing primer binding sites are highlighted; the deleted C is highlighted in red.

References

  1. Zhang, D., Tomisato, W., Su, L., Sun, L., Choi, J. H., Zhang, Z., Wang, K., Zhan, X., Choi, M., Li, X., Castro-Perez, J. M., Hildebrand, S., Murray, A. R., Moresco, E. M. Y., and Beutler, B. (2017) Skin-Specific Regulation of SREBP Processing and Lipid Biosynthesis by Glycerol Kinase 5. Proc Natl Acad Sci USA. 114, E5197-E5206.

  2. Hurley, J. H., Faber, H. R., Worthylake, D., Meadow, N. D., Roseman, S., Pettigrew, D. W., and Remington, S. J. (1993) Structure of the Regulatory Complex of Escherichia Coli IIIGlc with Glycerol Kinase. Science. 259, 673-677.

  3. Ormo, M., Bystrom, C. E., and Remington, S. J. (1998) Crystal Structure of a Complex of Escherichia Coli Glycerol Kinase and an Allosteric Effector Fructose 1,6-Bisphosphate. Biochemistry. 37, 16565-16572.

  4. Zhang, Y., Zagnitko, O., Rodionova, I., Osterman, A., and Godzik, A. (2011) The FGGY Carbohydrate Kinase Family: Insights into the Evolution of Functional Specificities. PLoS Comput Biol. 7, e1002318.

  5. Hurley, J. H. (1996) The Sugar kinase/heat Shock Protein 70/actin Superfamily: Implications of Conserved Structure for Mechanism. Annu Rev Biophys Biomol Struct. 25, 137-162.

  6. Yeh, J. I., Charrier, V., Paulo, J., Hou, L., Darbon, E., Claiborne, A., Hol, W. G., and Deutscher, J. (2004) Structures of Enterococcal Glycerol Kinase in the Absence and Presence of Glycerol: Correlation of Conformation to Substrate Binding and a Mechanism of Activation by Phosphorylation. Biochemistry. 43, 362-373.

  7. Di Luccio, E., Petschacher, B., Voegtli, J., Chou, H. T., Stahlberg, H., Nidetzky, B., and Wilson, D. K. (2007) Structural and Kinetic Studies of Induced Fit in Xylulose Kinase from Escherichia Coli. J Mol Biol. 365, 783-798.

  8. Thorner, J. W., and Paulus, H. (1973) Catalytic and Allosteric Properties of Glycerol Kinase from Escherichia Coli. J Biol Chem. 248, 3922-3932.

  9. Huq, A. H., Lovell, R. S., Sampson, M. J., Decker, W. K., Dinulos, M. B., Disteche, C. M., and Craigen, W. J. (1996) Isolation, Mapping, and Functional Expression of the Mouse X Chromosome Glycerol Kinase Gene. Genomics. 36, 530-534.

  10. Flaherty, K. M., McKay, D. B., Kabsch, W., and Holmes, K. C. (1991) Similarity of the Three-Dimensional Structures of Actin and the ATPase Fragment of a 70-kDa Heat Shock Cognate Protein. 88, 5041-5045.

  11. de Riel, J. K., and Paulus, H. (1978) Subunit Dissociation in the Allosteric Regulation of Glycerol Kinase from Escherichia Coli. 2. Physical Evidence. Biochemistry. 17, 5141-5146.

  12. de Riel, J. K., and Paulus, H. (1978) Subunit Dissociation in the Allosteric Regulation of Glycerol Kinase from Escherichia Coli. 1. Kinetic Evidence. Biochemistry. 17, 5134-5140.

  13. de Riel, J. K., and Paulus, H. (1978) Subunit Dissociation in the Allosteric Regulation of Glycerol Kinase from Escherichia Coli. 3. Role in Desensitization. Biochemistry. 17, 5146-5150.

  14. Anderson, C. M., Stenkamp, R. E., McDonald, R. C., and Steitz, T. A. (1978) A Refined Model of the Sugar Binding Site of Yeast Hexokinase B. J Mol Biol. 123, 207-219.

  15. Flaherty, K. M., DeLuca-Flaherty, C., and McKay, D. B. (1990) Three-Dimensional Structure of the ATPase Fragment of a 70K Heat-Shock Cognate Protein. Nature. 346, 623-628.

  16. Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F., and Holmes, K. C. (1990) Atomic Structure of the Actin:DNase I Complex. Nature. 347, 37-44.

  17. Rahib, L., Sriram, G., Harada, M. K., Liao, J. C., and Dipple, K. M. (2009) Transcriptomic and Network Component Analysis of Glycerol Kinase in Skeletal Muscle using a Mouse Model of Glycerol Kinase Deficiency. Mol Genet Metab. 96, 106-112.

  18. Ohira, R. H., Dipple, K. M., Zhang, Y. H., and McCabe, E. R. (2005) Human and Murine Glycerol Kinase: Influence of Exon 18 Alternative Splicing on Function. Biochem Biophys Res Commun. 331, 239-246.

  19. MacLennan, N. K., Rahib, L., Shin, C., Fang, Z., Horvath, S., Dean, J., Liao, J. C., McCabe, E. R., and Dipple, K. M. (2006) Targeted Disruption of Glycerol Kinase Gene in Mice: Expression Analysis in Liver shows Alterations in Network Partners Related to Glycerol Kinase Activity. Hum Mol Genet. 15, 405-415.

  20. Wibmer, T., Otto, J., Parhofer, K. G., and Otto, C. (2005) Novel Mutation (Gly280Ala) in the ATP-Binding Domain of Glycerol Kinase Causes Severe Hyperglycerolemia. Exp Clin Endocrinol Diabetes. 113, 396-403.

  21. Brisson, D., Vohl, M. C., St-Pierre, J., Hudson, T. J., and Gaudet, D. (2001) Glycerol: A Neglected Variable in Metabolic Processes? Bioessays. 23, 534-542.

  22. Sjarif, D. R., Ploos van Amstel, J. K., Duran, M., Beemer, F. A., and Poll-The, B. T. (2000) Isolated and Contiguous Glycerol Kinase Gene Disorders: A Review. J Inherit Metab Dis. 23, 529-547.

  23. Robergs, R. A., and Griffin, S. E. (1998) Glycerol. Biochemistry, Pharmacokinetics and Clinical and Practical Applications. Sports Med. 26, 145-167.

  24. Watford, M. (2000) Functional Glycerol Kinase Activity and the Possibility of a Major Role for Glyceroneogenesis in Mammalian Skeletal Muscle. Nutr Rev. 58, 145-148.

  25. Ashokkumar, C., Ningappa, M., Ranganathan, S., Higgs, B. W., Sun, Q., Schmitt, L., Snyder, S., Dobberstein, J., Branca, M., Jaffe, R., Zeevi, A., Squires, R., Alissa, F., Shneider, B., Soltys, K., Bond, G., Abu-Elmagd, K., Humar, A., Mazariegos, G., Hakonarson, H., and Sindhi, R. (2011) Increased Expression of Peripheral Blood Leukocyte Genes Implicate CD14+ Tissue Macrophages in Cellular Intestine Allograft Rejection. Am J Pathol. 179, 1929-1938.