Phenotypic Mutation 'turtle'

• Allele: turtle
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 69,448,109 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Efnb3
• Gene Name: ephrin B3
• Synonym(s): Epl8, NLERK-2, ELF-3, Elk-L3, EFL-6, LERK-8
• Chromosomal Location: 69,444,918-69,451,031 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit a hopping gait due to corticospinal tract defects, mutations that remove only the cytoplasmic domain of the protein do not result in the gait or CNS phenotypes, and a G244E mutation causes ataxia [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: O35393
• PDB Structure: Crystal Structures of Nipah Virus G Attachment Glycoprotein in Complex with its Receptor Ephrin-B3 [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000004036; Gene: ENSMUSG00000003934; AA Change: L111P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Ephrin	28	167	2.8e-45	PFAM
transmembrane domain	225	247	N/A	INTRINSIC
low complexity region	264	291	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000004036)
• Meta Mutation Damage Score: 0.9414
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• MMRRC Submission: 036909-MU
• Last Updated: 2018-05-22 9:45 AM by Anne Murray
• Record Created: 2012-03-14 10:14 AM by Bruce Beutler
• Record Posted: 2014-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Tiana Purrington, Bruce Beutler

Accession Number

Ncbi Refseq: NM_007911.5; MGI: 109196

Alleles Listed at MGI

All alleles(9) : Targeted(9)

Phenotypic Description

Figure 1. Characteristic movements of the turtle phenotype. The mouse cannot right himself after being turned on his back.

Figure 2. The turtle mice exhibit mirror movements and a hopping gate when older.

The turtle mouse was visually identified among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU) by a defect in their ability to right themselves when placed on their back and an inability to stay standing (Figure 1); turtle displays normal behavior (e.g., feeding and grooming). Older animals exhibit a "hopping" or mirror movements when walking and running (Figure 2).

Nature of Mutation

Figure 3. DNA trace.

Whole genome SOLiD sequencing of the G1 grandsire identified 19 mutations. Three G3 mice with the turtle phenotype and six unaffected mice were genotyped at all 19 mutation sites and three mutations on chromosome 11 were homozygous in all three of the turtle mice but none of the unaffected mice. Capillary sequencing of the mutated genes identified a T to C transition at base pair 69370785 (v37) on Chromosome 11 in the GenBank genomic region NC_000077 encoding Efnb3 (Figure 3). The mutation corresponds to residue 332 in the mRNA sequence within exon 2 of 5 total exons.

316 CGGCCAGACCTGGACCTCCGCTTCACCATCAAG 106 -R--P--D--L--D--L--R--F--T--I--K-

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at residue 111.

Protein Prediction

Efnb3 encodes the highly conserved (i.e., homology between human and mouse ephrin-B3 is >96%) ephrin-B3, a member of the membrane-associated ephrin family of ligands (1-3).  The ephrin ligands and the ephrin (Eph) tyrosine kinase receptors each have two subfamilies, ephrin-A and ephrin-B or EphA and EphB, respectively (1;3). Ephrin-A ligands preferentially bind to EphA receptors (caveat: the EphA4 receptor (see the record for frog) can also recognize ephrin-B3), while ephrin-B ligands bind preferentially to EphB receptors (1;4-7).  Ephrin-B3, in particular, binds with nanomolar affinity to EphB3, but does not have high affinity for the other EphB receptors (i.e., EphB1, EphB2, or EphB4) (1)

Figure 4. The ephrin-B3 protein domains. Efnb3 encodes the 340 amino acid ephrin-B3 protein. The extracellular and intracellular portions of the protein are marked. The N-terminal 27 amino acids are the signal peptide (SP), amino acids 228-248 are the transmembrane (TM) domain (TM), amino acids 28-167 are the receptor binding domain (RBD), and amino acids 338-340 are the PDZ binding motif (PDZ). The turtle mutation is a leucine to proline substitution at residue 111 within the extracellular ephrin RBD. See the text for more details about this protein.

The ephrin-B ligand subfamily has three members: ephrin-B1 (alternatively LERK-2/Elk-L/Cek5-L), eprhin-B2 (alternatively, ELF-2/Htk-L), and eprhin-B3; ephrin-B3 shares 48.8% and 49.3% amino acid homology with ephrin-B1 and ephrin-B2, respectively (1). Ephrin-B ligands are anchored to the membrane by a hydrophobic transmembrane domain [amino acids 228-248 in ephrin-B3; Figure 4; (1;3).  The N-terminus  of ephrin-B3 (amino acids 1-27) is a signal peptide for secretion (1), amino acids 28-227 are extracellular, and a highly conserved cytoplasmic tail (amino acids 249-340) can become tyrosine phosphorylated as well as associate with SH2 and PDZ domain-containing proteins (3;4;8;9).

Several residues within the extracellular domain of ephrin-B3 are essential for its function.  Using a C-terminal truncation mutant, Holen et al. determined that the heparin-binding region is within amino acids 178-194 [(10); see “Background”, below, for more details]. Site-directed mutagenesis of four basic residues within this region (Arginine (Arg; R)178, Lysine (Lys; K)179, Arg188, and Arg190) determined that, upon substitution of a glycine (Gly; G) for Arg178 or an asparagine (Asn; N) for Lys179, heparin binding was decreased; a double mutant (R178G/K179N) did not bind heparin at all (10).  Substitutions of Arg188 or Arg190 for glycines caused no change in binding (10). Taken together, these results indicate that Arg178 and Lys179 constitute a binding site for heparin (10). Arg188 was identified as an essential amino acid for binding of ephrin-B3 to B lymphocytes [(11); see “Background”, below, for more details]. Reelin also associates with the extracellular domain of ephrin-b3 [(12); see “Background”, below, for more details].

The cytoplasmic domain of ephrin-B3 is required to mediate reverse signaling events (see “Background” for more details) as well as to interact with SH2/SH3 adaptor molecules (e.g., Grb4; alternatively, Nck2), tyrosine phosphatases (e.g., PTP-BL; alternatively, Ptpn13), and PDZ adaptor molecules (e.g., GRIP1/2 and PDZ-RGS3) [(13;14); reviewed in (15)]. Examination of ephrin-B3 cytoplasmic deletion mutants determined that the regulation of synaptic numbers, regulation of the expression of synaptosomal protein GRIP, and the phosphorylation of PKA are all dependent on the cytoplasmic domain (13;14). Although ephrin-B3 contributes to regulating synaptic transmission, modulation of synaptic protein expression, and hippocampal-dependent memory, these processes are independent of its cytoplasmic domain (13). Upon axon-dendrite contact and postsynaptic ephrin-B3 association with a presynaptic EphB receptor, ephrin-B3 can recruit Grb4 or Pick1/syntenin via SH2 or PDZ binding motifs, respectively (3). Grb4 and Pick1 bridge ephrin-B3 to cytoskeletal regulators, receptors and ion channels thereby altering their subcellular targeting and/or surface expression to subsequently facilitate bi-directional signaling (3;8;16-18).  For example, Grb4 can couple ephrin-B3 to Dock180 and PAK, leading to signaling downstream of Rac and Cdc42 to function in dendritic growth and remodeling as well as in mossy fiber axon pruning (18;19).

The transmembrane domains of B-type ephrins are targets for cleavage by human RHBDL2, an intramembrane rhomboid protein (see the record for sinecure for more information about rhomboid proteases); human rhomboids RHBDL1 and RHBDL4 did not cleave ephrin-b3 (2). In vitro analysis of an ephrin-B3 truncated at Arg214, Pro226, or Cys250 determined that the Pro226 truncation mutant was similar in molecular weight to the protein product cleaved by RHBDL2, indicating that ephrin-B3 is cleaved close to this residue (2). The physiological relevance of RHBDL2-mediated cleavage of ephrin-B3 remains to be elucidated (2). However, Pascall et al. propose that release of a soluble form of ephrin-B3 functions as an inhibitor of Eph/Ephrin-mediated cell interactions (2).

Figure 5. Crystal structure of the ephrin-B2 ectodomain. The ectodomain is an eight-stranded β barrel arranged in two sheets (the mixed parallel and antiparallel β strands are arranged in a Greek key topology) around a hydrophobic core; two α helices and one 3₁₀ helix is interspersed between the β strands. Key residues of interest are labeled in the color that coordinates to the location in the crystal structure; functionally significant residues are described in the text. Area I (cyan), Area II (red), and residues common to both (green) are shown as well as the disulfide bonds between Cys92-Cys156 (peach) and Cys65-Cys104 (purple). The figure is based on PDB: 1IKO.

Figure 6. Ephrin-B2 has two highly conserved surface regions, Area I and Area II. Area I is a small hydrophobic concave pocket that is critical for Eph receptor binding and distinguishing between the EphA and EphB classes. Area II is involved in ligand dimerization and protease activation. Figure adapted from PDB: 1IKO and ( 7 ) .

The crystal structure of the ephrin-B2 ectodomain has been solved and associates as dimers [PDB: 1IKO; (7); Figure 5]. The ectodomain is an eight-stranded β barrel arranged in two sheets (the mixed parallel and antiparallel β strands are arranged in a Greek key topology) around a hydrophobic core; two α helices and one 3₁₀ helix are interspersed between the β strands (7). Two buried disulfide bonds increase the stability of the ectodomain: the bond between Cys65 and Cys104 connects β strands C and F; Cys92 and Cys156 bond anchors two small helices, E and J, at the top of the barrel (7). Similar to other ephrins, ephrin-B2 is N-linked glycosylated at Asn39, but the function of this posttranslational modification is unknown (7). On either side of the G-H loop are two conserved surface regions, Area I and Area II [(7); Figure 6]. Area I is a small hydrophobic concave pocket that is critical for Eph receptor binding and distinguishing between the EphA and EphB classes (7).  Area II is involved in ligand dimerization and protease activation (7).

The ephrin-B3 ligand can bind the EphB receptors, EphA4, heparin, an unknown heparan-sulfated proteoglycan (HSPG) receptor on HeLa and HEK-293T cells, and an unidentified protein expressed on B cells (11;18;20). Eprhin-B3 has a putative heparin/heparin sulfate-binding domain that is unique from its Eph-receptor-binding domain (10).  Signaling through the HSPG receptor regulates cell morphology and cell spreading; ehprin-B3 binding to the receptor can be blocked by heparin (10).  B-lymphocytes (namely CD19⁺ B lymphocytes) are the only peripheral blood mononuclear cells that can also bind ephrin-B3 (11). The receptor on the B cell is unknown; Holen et al. propose that it is not an EphB receptor or a HSPG (11).  Stimulation by ephrin-B3 leads to increased migration of IgD⁻ memory B lymphocytes; naïve B lymphocytes did not migrate as efficiently as the memory subpopulation (11). Eprhin-B3 also enhances Cxcl12- and Ccl19-induced migration of B lymphocytes (11). Ephrin-B3 binding to B cells is downregulated following B cell activation, pointing to a possible role for ephrin-B3-B cell association in non-stimulated cells (11).

The turtle mutation is a leucine to proline substitution at residue 111 within the extracellular ephrin receptor binding domain (RBD; aa 28-167; UniProt).

Expression/Localization

In situ hybridization of whole mount mouse embryos detected strongest Efnb3 expression in the floor plate of the midbrain and hindbrain; weaker expression was detected in the dorsal hindbrain, in rhombomeres 2,4,6 (1). At embryonic day (E) 14, Efnb3 was strongly expressed in the preoptic area and along the superficial migratory stream (21).  At E15 and 16, the expression was detected in the dorsal midline of the hindbrain and spinal cord (1;22). At postnatal day (P) 0, Efnb3 expression was detected in the mouse midbrain in mesostriatal dopaminergic neurons (20). At P10.5, 11.5, and 12.5 expression was detected in the floor plate (1;23;24). In situ hybridization has also detected high levels of Efnb3 in the granule layer of the hippocampal dentate gyrus and in CA1 neurons (25;26).

Ephrin-B3 can be either pre- (13;27) or postsynaptic (25;28). Antibody labeling of ephrin-B3 detected strong expression of ephrin-B3 in floor plate cells of the developing nervous system (24). In primary dissociated rat cortical neurons, at 5-10 days in vitro, eprhin-B3 is enriched at excitatory synapses and also localized to many extrasynaptic locations (28).  At 14-21 days in vitro, dendritic spine formation occurs and eprhin-B3 is largely restricted to spine and shaft excitatory synaptic contacts (28). In postnatal tissues, ephrin-B3 is expressed in the myelinating oligodendrocytes in the mouse spinal cord, and optic nerve as well as in tissues surrounding the subventricular zone and rostral migratory stream of the brain (e.g., cortex, striatum, septum, and corpus callosum); expression of ephrin-B3 is not detected at the midline in adults or within the subventricular zone and rostral migratory stream (29-33). Additional studies detected high levels of the eprhin-B3 protein within the dentate gyrus in the hilus and the inner molecular layer; lower levels were detected in the outer molecular layer (5).  The Efnb3^-/- mouse has defective cell positioning of stem/progenitor cells outside of the subgranular zone of the hippocampal dentate gyrus as well as abnormal cellular processes extending into the hilus (5).  Ephrin-B3 is also localized to post-synaptic CA1 dendrites and pre-synaptic mossy fibers (3;13;18). Although ephrin-B3 expression has been detected in the adult brain, it is not a phosphorylated form, indicating that it may not be active in physiological processes of the adult brain (4). Ephrin-B3 is also expressed in the white pulp of the spleen: 30.4% of resting T cells and 30.1% of activated (24 hours) T cells express ephrin-B3 (34). Expression of eprhin-B3 on CD4 and CD8 T cells was similar (26.1 and 22.1%, respectively); the CD4 cells expressed more of the ephrin-B3 receptor than CD8 cells (45.4 and 21.3%, respectively) (34).  The expression of ephrin-B3 or its receptor was barely detectable in B cells, but a significant percentage of monocytes/macrophages expressed ephrin-B3 (20.4%) (34). In the cancer cell lines U251 and SNB19, ephrin-B3 was localized to the leading edge at sites of lamellipodial formation (4).

Background

Figure 7. Overview of ephrin-B-mediated bidirectional signaling. In forward signaling, the Eph receptor is autophosphorylated upon receptor-ligand interaction on several juxtamembrane tyrosine residues. GRB4 (growth factor receptor bound protein-4) subsequently interacts with the receptor to facilitate signaling that results in changes in integrin activity and reorganization of the actin cytoskeleton. In reverse signaling, upon interaction with the Eph receptor, the ephrin ligand is phosphorylated, resulting in the association of GRB4 to the PDZ domain. In ephrin-B1-mediated signaling, GRB4 can subsequently recruit signaling molecules (e.g., FAK, Axin, Abi1, CAP, and Cbl [not shown]) to the signaling complex, eventually leading to changes in actin dynamics (see the record for frog for more information on EphA4/ephrin-B-mediated signaling affects on actin dynamics). Ephrin-B signaling can also induce the downregulation of MAPK/ERK pathway. Ephrin-B3 induces the phosphorylation of the NR2 subunit of the NMDA receptor (NMDAR), which subsequently functions in long-term potentiation (LTP), learning, memory, synaptic maturation, and synaptogenesis. Ephrin-B3 can also function in Reelin signaling. The secreted extracellular protein, Reelin, binds to ephrin-B proteins and subsequently associates at the membrane with the Reelin receptors, VLDLR and ApoER2 (not shown). Reelin-associated signaling functions in regulating axonal transport, neuronal migration, microtubule dynamics, and actin reorganization during neuronal migration in the brain.

The ephrins and the Eph receptors have several functions including the regulation of axon growth and pathfinding, vascular patterning, and cell adhesion as well as synaptic development, plasticity, and regulation in the hippocampus (3;6;10;13;35-40). In the regulation of axon growth and synaptic plasticity, ephrin/Eph receptor activation can function to repulse neighboring cells or cellular projections such as in axonal growth cone collapse (2) and in dendrite growth and arborization (i.e., branching at the end of a nerve fiber) in developing CA1 pyramidal neurons (3). Upon cell-cell contact, ephrins and Eph receptors can mediate signaling bidirectionally (Figure 7).  In forward signaling, the Eph receptor transduces the ephrin-mediated signal in the receptor-expressing cell (e.g., presynaptic ephrin-B promotes spine synapse formation through activation of postsynaptic EphB receptor signaling (41;42)). Reverse signaling occurs in the ligand-expressing cell to activate intracellular signaling pathways [e.g., regulation of synapse formation (43) or axon pruning (18)] (4;8;22;44-46).

Ephrin-B3-mediated signaling can regulate several functions including apoptosis (40), T-cell signaling (34), axon guidance to regulate corticospinal tract projection (47), and axon pruning (11;18;20).

Ephrin-B3 and the central nervous system

Regulation of NMDA receptors

Regulation of the NMDA receptors modulates glutamatergic synaptic transmission, a process essential for the development and function of the central nervous system (48). Ephrin-B3 hypomorphic mice have an enhanced ratio of NMDA receptor- to AMPA receptor-mediated excitatory postsynaptic currents (EPSCs) (48). Furthermore the hypomorphic mice have reduced excitatory postsynaptic potential amplitudes and a reduction in synaptic weight, indicating that they have fewer AMPA receptors; synaptic NMDA receptors were not altered (48). Ephrin-B3 limits EphB2-mediated phosphorylation of the N-Methyl-D-Aspartate (NMDA) receptor NR2 subunit; phosphorylation of the subunit is enhanced in Efnb3^-/- mice (25;48).  EphB2 interaction with the NMDA receptors in the postsynaptic density (PSD) of excitatory synapses in CA1 neurons of the hippocampus modulates calcium influx into the postsynaptic cells to subsequently function in long-term potentiation (LTP), learning, memory, synaptic maturation, and synaptogenesis (13;25;41;48;49). Taken together, these studies show that ephrin-B3 is required for the regulation of the NMDA receptor and maturation of glutamatergic synaptic transmission (48).  In support of this, Efnb3^-/- mice have reduced CA3-CA1 LTP along with defective learning and memory tasks (13).

Synaptic formation, maturation, and density

Eprhin-B3 functions in the formation and maturation of excitatory synapses as well as in the regulation of synapse density by inhibiting postsynaptic MAPK signaling (28;50). In vitro, shRNA-mediated knockdown of Efnb3 leads to a significant reduction in dendritic spine density, spine synapses, and shaft synapses (28;43). In Efnb3^-/- mice, the density of dendritic protrusions was significantly reduced with a concomitant reduction in dendritic spine density; synapse density was not changed (28). McClelland et al. addressed the apparent discrepancy between the in vitro knockdown and in vivo knockout data (28). They determined that the relative level of ephrin-B3 can selectively increase or decrease the density of synapses, suggesting that cell-to-cell differences in ephrin-B3 expression enables neuronal competition to control synapse density (28). To support this, heterogenotypic cultures of Efnb3^-/- and wild-type neurons showed that neurons expressing higher levels of ephrin-B3 formed more synapses and that there was competition for the presynaptic ligand, EphB2 (28). Expression of a dominant negative MEK rescued any defects in the heterogenotypic cultures, indicating that ephrin-B3-mediated control of synapse density is dependent on ERK signaling (28). Furthermore, McClelland et al. determined that eprhin-B3 interacts with ERK and subsequently negatively regulates ERK signaling (28).

Ephrin-B3 and Reelin signaling

During the development of laminated structures and neuronal migration in the brain, ephrin-B proteins (i.e., ephrin-B1, ephrin-B2 and ephrin-B3) facilitate Reelin signaling, a signaling pathway essential for central nervous system (CNS) development (12). Compound mouse mutants (null for ephrin-B3 or ephrin-B2 and heterozygous for Reelin) and a triple ephrin-B1, B2, B3 knockout exhibited neuronal migration defects with a significant increase in neurons in the marginal zone as well as defects in hippocampal laminated structures (12).  Reelin, an extracellular protein secreted by neurons, binds to the extracellular domain of ephrin-B proteins and subsequently associates at the membrane with Reelin receptors, VLDLR and ApoER2 (12). Binding of Reelin to ephrin-B3 also leads to ephrin-B3 clustering, a process necessary for the recruitment and phosphorylation of Dab1, an adaptor protein necessary for Reelin signaling (12).

Figure 8. Ephrin-B3 serves as a midline repellant during corticospinal tract (CST) pathfinding. (top) Model of embryonic brain anatomy. Color divisions match the coronal sections shown below. (bottom) Coronal sections through the forebrain (top, pink), hindbrain (middle, purple), and spinal cord (bottom, green) are shown. In the views of the CST, the left side cortical neurons are colored in red, the right side neurons are colored in blue. The spinal cord section shows the CST fibers located as a fasciculated longitudinal bundle in the contralateral dorsal column. Collateral fibers branch off the midline fascicle and project into the ventral horn to innervate the appropriate contralateral motor neurons, which are colored according to their cortical input. Ephrin-B3 is concentrated at the midline of the nervous system and prevents collateral fibers of the CST from projecting across the midline. Figure is adapted from Yokoyama et al. ( 2001 ).

Ephrin-B3 is a midline repellant

During development, corticospinal neurons in the motor cortex send axons toward the ipsilateral side of the ventral hindbrain via the internal capsule/pyramidal tract (51) (Figure 8).  In the caudal medulla, the growth cones of the corticospinal tract cross the midline and travel down the spinal cord in the contralateral dorsal column, forming a bundle (51). Ephrin-B proteins function in promotion of the collapse of commissural growth cones at this stage, helping to prevent aberrant recrossing of the midline (24). At the appropriate site of the spinal cord, individual axons branch and enter the contralateral side of the spinal cord to innervate the appropriate motor neurons (51). The axons only cross the midline once and are prevented from crossing back over through eprhin-B3-induced EphA4 signaling (29;47;51;52).  Disruption of the EphA4 (or EphB) and eprhin-B3 interaction cause decussated (i.e., crossed or intersected) commissural axons to inappropriately invade the dorsal regions of the spinal cord (24).

Axon growth, guidance and regeneration

In addition to its role as a midline repellant, eprhin-B3 is also proposed to function in regulating the growth and guidance of axons in the injured adult CNS (20;21;24;30;36;51). Duffy et al. found that after CNS trauma (e.g., optic nerve crush or dorsal hemisection of the thoracic spinal cord), ephrin-B3 in myelinating oligodendrocytes, along with the myelin-derived inhibitors Nogo, MAG, and OMgp, limits recovery through its inhibition of axon growth (30). In Efnb3 knockout animals (Efnb3^-/-), corticospinal and raphespinal growth in the caudal spinal cord after CNS injury was significantly improved over wild-type animals (30). Furthermore, the Efnb3^-/- animals had improved locomotor function (30).  After optic nerve crush injury, the Efnb3^-/- mouse also had significantly greater optic nerve regeneration (30). In vitro, CNS myelin extracts inhibited neurite outgrowth of dorsal root ganglion cells; loss of ephrin-B3 expression reduced this inhibitory activity (30). Another study found that ephrin-B3 supports adult retinal ganglion cell axon growth in vitro (36). In Efnb3^-/-mice, loss of eprhin-B3 expression led to a decrease retinal ganglion cell axon sprouting after optic nerve injury (36). This study found that the loss of axonal plasticity was not due to a change in the growth potential of the axon after injury (36). A third study found that after transient focal cerebral ischemia, neurogenesis is increased in the Efnb3^-/- mouse without a concomitant neurological recovery (38). However, signal transducer and activator of transcription 1 (STAT1)-associated brain injury is enhanced (38) Doeppner et al. determined that the Efnb3^-/- mouse had increased cell proliferation rates of neural progenitor cells as well as increased astroglial and neuronal differentiation rates (38).

Neurogenesis and apoptosis

The subventricular zone (SVZ) is a region of the brain in which neurogenesis occurs in adults (53).  Neural progenitor cells in the SVZ differentiate into neuroblasts that terminally differentiate into interneurons in the olfactory bulb (32;54;55). In the adult brain, blockade of ephrin-B3 results in increased proliferation and migration of SVZ-derived neural precursor cells (32;33). In Efnb3^-/- mice, cell proliferation was increased along the lateral ventricle; the increased proliferation in these animals could be reduced by the infusion of soluble ephrin-B3 (32). Ricard et al. propose that ephrin-B3-mediated signaling (via EphB3 or EphA4 receptors) upregulates cell cycle activators (e.g., PCNA) and downregulates cell cycle inhibitors (e.g., cyclin-dependent kinase inhibitor p27^Kip1) (32).  In addition to its role in cell proliferation, ephrin-B3 can also regulate cell apoptosis in neurogenic regions in the adult (32). In adult mice, loss of ephrin-B3 expression leads to an increase in TUNEL-positive cells in the SVZ (32;40).  Ephrin-B3 can prevent EphA4-mediated pro-apoptotic effects: EphA4 is a dependence receptor that is cleaved by caspase-3-like caspase, leading to caspase-dependent cell death in the absence of ephrin-B3 (40). In an ephrin-B2 study, Sawamiphak et al. determined that ephrin-B2 functions in cell apoptosis by regulating the activity of vascular endothelial growth factor (VEGF) receptor 2 (56); the role of ephrin-B3 in the regulation of VEGFR2 activity has not been examined.

Ephrin-B3 and cancer

Studies have shown that ephrin-B3 functions in cancer progression. Ephrin-B3 is upregulated in migrating glioma cell lines and changes in the expression of ephrin-B3 alters the invasion and migration of human glioma cells: siRNA-mediated knockdown inhibits invasion and migration, while forced expression induces invasion and migration both in vitro and ex vivo (4). In addition, the phosphorylation level of ephrin-B3 directly correlated with the amount of glioma migration and invasion rates (4). Further examination determined that ephrin-B3 mediates the changes in glioma invasion by activating Rac1, a protein known to stimulate cell migration through actin reorganization and the formation of lamellipodia (4;57;58). In U-810 cells, a non-small cell lung cancer cell line, ephrin-B3 silencing led to decreased proliferation and a change to a flattened, elongated morphology (from a small round morphology) of the cells (44).  To determine the ephrin-B3 signaling network that could be contributing to these changes in the U-810 cells, ephrin-B3-dependent changes in the phosphorylation status of the proteome were examined by mass spectrometry (44).  Stahl et al. determined a network of proteins, including active EphA2 and focal adhesion kinase 1 (FAK1), are involved in ephrin-B3-mediated cell survival signaling to mediate changes in growth, morphology and invasiveness (44).  Stahl et al. propose that ephrin-B3 blocks the interaction of ephrin-A1 with the EphA2 receptor; Akt1 subsequently phosphorylates EphA2, activating downstream signaling through FAK1 (44).  In general, the proteins in the network function to control cellular assembly and organization, cellular development, and cell morphology (44).  This study confirmed that ephrin-B3 binds to and results in phosphorylation of the EphA2 receptor, subsequently preventing the binding of ephrin-A1 to the receptor and promoting cell survival (44).

Ephrin-B3 and T cell signaling

Ephrin-B3 has a role in T-cell activation and function. In vitro stimulation of T cells by ephrin-B3 in the presence of anti-CD3 resulted in increased proliferation and cytotoxic T lymphocyte activity, production of IFN-γ, and the expression of certain T-cell activation markers (e.g., CD69) (34). T cell receptor (TCR) crosslinking using anti-CD3 antibodies resulted in congregation of ephrin-B3 receptors (various Ephs) with TCRs in aggregated lipid rafts, providing a physical basis for the potential interaction between TCR and Eph pathways (34). Yu et al. propose that ephrin-B3 is important for T-cell/T-cell and T-cell/antigen-presenting cell collaboration to encourage T-cell activation and function (34).

Ephrin-B3 as a henipavirus receptor

Ephrin-B2 and –B3 are unique among the ephrin ligands in that they function as entry receptors for henipaviruses, deadly zoonotic paramyxoviruses (i.e., Nipah virus in pigs and Hendra virus in horses); human infection occurs after contact with either the infected pigs or horses (59-62). Henipavirus entry in the cell is through the attachment of the viral G envelope glycoprotein with either of the ephrin-B proteins, followed by activation of the F fusion protein (a type-I transmembrane glycoprotein), and subsequent fusion of the viral envelope and the host membrane (62). Ephrin-B3 interacts with the viral G envelope glycoprotein at the hydrophobic region on the G-H loop, which includes residues Trp125, Leu124, Pro122, and Tyr/Phe120 [PBD: 3D12; (60;62;63)]; the leucine and tryptophan residues are critical for binding of the Nipah virus G protein (60). Upon interaction with the G protein, the ephrin-B3 G-H loop undergoes a conformational change to enhance binding of ephrin-B3 to the G protein (62). Interaction of ephrin-B3 with the henipavirus is not proposed to induce ephrin-B3-mediated reverse signaling (62).

Putative Mechanism

The Efnb3^-/- mouse exhibits a kangaroo/rabbit-like “hopping” phenotype similar to turtle [MGI: 3026700; (51) and MGI: 2388046; (47;52)]. Yokoyama et al. observed that the corticospinal tract of the Efnb3^-/- mouse was defective in that axons bilaterally innervated both contralateral and ipsilateral motor neuron populations, indicating that ephrin-B3 functions as a midline repellant (51). Further studies by Kullander et al. demonstrated that the “hopping” gate of the Efnb3^-/- mouse was linked to defects in local spinal neuronal networks that generate and coordinate the contraction and relaxation of muscles, termed central pattern generators (52). This study determined that the normal rhythmic pattern in isolated spinal cords from Efnb3^-/- mouse was defective at 0 to 5 days, and therefore independent of the corticospinal tract (52). Bilateral ventral roots exhibited an abnormal synchronous rhythm as opposed to the wild-type left-right alternation (52). Ipsilateral lumbar (L) segment 2 and L5 ventral roots had a normal alternating pattern in the knockouts (52). In another study, Restrepo et al. found that in EphA4 knockout mice that there was an increase in the number of crossing excitatory neurons and an increase in inhibitory neurons crossing the midline compared to EphA4 heterozygous mice (64). Taken together, these findings indicate that ephrin-B3-induced EphA4 signaling (see the record for frog) functions to repel components of the spinal central pattern generators and restricts their axonal projections to one side of the spinal cord  (52).  In addition, due to changes to EphA4 signaling in the Efnb3^-/- mouse, the balance between excitatory and inhibitory signals across the midline are altered leading to the hopping phenotype (52;64).

The phenotype observed in turtle indicates that the leucine to proline mutation at residue 111 is detrimental to ephrin-B3-mediated signaling.  It is possible that this mutation impairs the ability of ephrin-B3 to bind to the EphA4 or EphB3 receptor, thus rendering it unable to function in bidirectional signalling during axon guidance.

Primers

Primers cannot be located by automatic search.

Genotyping

Figure. DNA sequencing trace of Chr. + strand

Turtle genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  The following primers are used for PCR amplification:

Primers for PCR amplification

Turtle(F):  5’-CGACTGAATGCCAAGGGAGCATTAC -3’

Turtle(R):  5’-GGGAGCTAAGAATTGCTGTCCGAG -3’

Primers for sequencing

Turtle_seq(F):  5’-CTGAATACCCAGTGGTGGATTCC -3’

PCR program

1) 94°C        2:00

2) 94°C        0:30

3) 57°C        0:30

4) 72°C        1:00

5) repeat steps (2-4) 29x

6) 72°C        7:00

7) 4°C            ∞

The following sequence of 515 nucleotides is amplified (Chr. 11: 69557082-69557596, GRCm38; NC_000077):

cgactgaatg ccaagggagc attactgaat acccagtggt ggattccaat ggctctaacc

ttcctccccc tccatcccac ggacactcta tttgcccctg ctcgacgtct ggcagtacca

attatgtagt aatcgtggtg ggatcggaac tcgtggcccc agaggttagg gctgtattcc

tggaacttga tggtgaagcg gaggtccagg tctggccggt cacatgtgag aagaaggttt

ggggcagggg gtgcctcaca acgccgaccc tgggcaccct ctaccaggta cagtttgtag

aactcataac taggagagga gtgggggcca ggaggccgag cccggggaca aagtagatct

agccggtccc cgatctgagg ataaagcacg taaccgccct ctgcctggaa cctacaggga

agacaaggta ggcagggaag aggtgtcagg ggtgtggcgc ccaaagcttt ccctctctca

ctcccaacca cctcggacag caattcttag ctccc

Primer binding sites are underlined; sequencing primers are highlighted; the mutated nucleotide is highlighted in red (A>G, Chr. + strand; T>C, sense strand).

References

  1. Bergemann, A. D., Zhang, L., Chiang, M. K., Brambilla, R., Klein, R., and Flanagan, J. G. (1998) Ephrin-B3, a Ligand for the Receptor EphB3, Expressed at the Midline of the Developing Neural Tube. Oncogene. 16, 471-480.

  2. Pascall, J. C., and Brown, K. D. (2004) Intramembrane Cleavage of ephrinB3 by the Human Rhomboid Family Protease, RHBDL2. Biochem Biophys Res Commun. 317, 244-252.

  3. Xu, N. J., Sun, S., Gibson, J. R., and Henkemeyer, M. (2011) A Dual Shaping Mechanism for Postsynaptic Ephrin-B3 as a Receptor that Sculpts Dendrites and Synapses. Nat Neurosci. 14, 1421-1429.

  4. Nakada, M., Drake, K. L., Nakada, S., Niska, J. A., and Berens, M. E. (2006) Ephrin-B3 Ligand Promotes Glioma Invasion through Activation of Rac1. Cancer Res. 66, 8492-8500.

  5. Chumley, M. J., Catchpole, T., Silvany, R. E., Kernie, S. G., and Henkemeyer, M. (2007) EphB Receptors Regulate stem/progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis. J Neurosci. 27, 13481-13490.

  6. Islam, S., Loizides, A. M., Fialkovich, J. J., Grand, R. J., and Montgomery, R. K. (2010) Developmental Expression of Eph and Ephrin Family Genes in Mammalian Small Intestine. Dig Dis Sci. 55, 2478-2488.

  7. Toth, J., Cutforth, T., Gelinas, A. D., Bethoney, K. A., Bard, J., and Harrison, C. J. (2001) Crystal Structure of an Ephrin Ectodomain. Dev Cell. 1, 83-92.

  8. Cowan, C. A., and Henkemeyer, M. (2002) Ephrins in Reverse, Park and Drive. Trends Cell Biol. 12, 339-346.

  9. Bruckner, K., Pasquale, E. B., and Klein, R. (1997) Tyrosine Phosphorylation of Transmembrane Ligands for Eph Receptors. Science. 275, 1640-1643.

  10. Holen, H. L., Zernichow, L., Fjelland, K. E., Evenroed, I. M., Prydz, K., Tveit, H., and Aasheim, H. C. (2011) Ephrin-B3 Binds to a Sulfated Cell-Surface Receptor. Biochem J. 433, 215-223.

  11. Holen, H. L., Zernichow, L., Fjelland, K. E., Evenroed, I. M., Tveit, H., and Aasheim, H. C. (2011) Ephrin-B3 Binds Specifically to B Lymphocytes in Blood and Induces Migration. Scand J Immunol. 74, 144-154.

  12. Senturk, A., Pfennig, S., Weiss, A., Burk, K., and Acker-Palmer, A. (2011) Ephrin Bs are Essential Components of the Reelin Pathway to Regulate Neuronal Migration. Nature. 472, 356-360.

  13. Rodenas-Ruano, A., Perez-Pinzon, M. A., Green, E. J., Henkemeyer, M., and Liebl, D. J. (2006) Distinct Roles for ephrinB3 in the Formation and Function of Hippocampal Synapses. Dev Biol. 292, 34-45.

  14. Bruckner, K., Pablo Labrador, J., Scheiffele, P., Herb, A., Seeburg, P. H., and Klein, R. (1999) EphrinB Ligands Recruit GRIP Family PDZ Adaptor Proteins into Raft Membrane Microdomains. Neuron. 22, 511-524.

  15. Martinez, A., and Soriano, E. (2005) Functions of ephrin/Eph Interactions in the Development of the Nervous System: Emphasis on the Hippocampal System. Brain Res Brain Res Rev. 49, 211-226.

  16. Beekman, J. M., and Coffer, P. J. (2008) The Ins and Outs of Syntenin, a Multifunctional Intracellular Adaptor Protein. J Cell Sci. 121, 1349-1355.

  17. Xu, J., and Xia, J. (2006) Structure and Function of PICK1. Neurosignals. 15, 190-201.

  18. Xu, N. J., and Henkemeyer, M. (2009) Ephrin-B3 Reverse Signaling through Grb4 and Cytoskeletal Regulators Mediates Axon Pruning. Nat Neurosci. 12, 268-276.

  19. Threadgill, R., Bobb, K., and Ghosh, A. (1997) Regulation of Dendritic Growth and Remodeling by Rho, Rac, and Cdc42. Neuron. 19, 625-634.

  20. Sun, J. H., Gao, Q., Zhang, J., Bao, L. H., Dong, H. M., Liang, N., Li, G. B., Li, Z. H., and Gao, Y. M. (2010) Ephrinb3 Induces Mesostriatal Dopaminergic Projection to the Striatum. Biochem Biophys Res Commun. 400, 194-199.

  21. Zimmer, G., Rudolph, J., Landmann, J., Gerstmann, K., Steinecke, A., Gampe, C., and Bolz, J. (2011) Bidirectional ephrinB3/EphA4 Signaling Mediates the Segregation of Medial Ganglionic Eminence- and Preoptic Area-Derived Interneurons in the Deep and Superficial Migratory Stream. J Neurosci. 31, 18364-18380.

  22. Gale, N. W., Holland, S. J., Valenzuela, D. M., Flenniken, A., Pan, L., Ryan, T. E., Henkemeyer, M., Strebhardt, K., Hirai, H., Wilkinson, D. G., Pawson, T., Davis, S., and Yancopoulos, G. D. (1996) Eph Receptors and Ligands Comprise Two Major Specificity Subclasses and are Reciprocally Compartmentalized during Embryogenesis. Neuron. 17, 9-19.

  23. Imondi, R., Wideman, C., and Kaprielian, Z. (2000) Complementary Expression of Transmembrane Ephrins and their Receptors in the Mouse Spinal Cord: A Possible Role in Constraining the Orientation of Longitudinally Projecting Axons. Development. 127, 1397-1410.

  24. Kadison, S. R., Makinen, T., Klein, R., Henkemeyer, M., and Kaprielian, Z. (2006) EphB Receptors and Ephrin-B3 Regulate Axon Guidance at the Ventral Midline of the Embryonic Mouse Spinal Cord. J Neurosci. 26, 8909-8914.

  25. Grunwald, I. C., Korte, M., Adelmann, G., Plueck, A., Kullander, K., Adams, R. H., Frotscher, M., Bonhoeffer, T., and Klein, R. (2004) Hippocampal Plasticity Requires Postsynaptic ephrinBs. Nat Neurosci. 7, 33-40.

  26. Liebl, D. J., Morris, C. J., Henkemeyer, M., and Parada, L. F. (2003) MRNA Expression of Ephrins and Eph Receptor Tyrosine Kinases in the Neonatal and Adult Mouse Central Nervous System. J Neurosci Res. 71, 7-22.

  27. Armstrong, J. N., Saganich, M. J., Xu, N. J., Henkemeyer, M., Heinemann, S. F., and Contractor, A. (2006) B-Ephrin Reverse Signaling is Required for NMDA-Independent Long-Term Potentiation of Mossy Fibers in the Hippocampus. J Neurosci. 26, 3474-3481.

  28. McClelland, A. C., Hruska, M., Coenen, A. J., Henkemeyer, M., and Dalva, M. B. (2010) Trans-Synaptic EphB2-Ephrin-B3 Interaction Regulates Excitatory Synapse Density by Inhibition of Postsynaptic MAPK Signaling. Proc Natl Acad Sci U S A. 107, 8830-8835.

  29. Benson, M. D., Romero, M. I., Lush, M. E., Lu, Q. R., Henkemeyer, M., and Parada, L. F. (2005) Ephrin-B3 is a Myelin-Based Inhibitor of Neurite Outgrowth. Proc Natl Acad Sci U S A. 102, 10694-10699.

  30. Duffy, P., Wang, X., Siegel, C. S., Tu, N., Henkemeyer, M., Cafferty, W. B., and Strittmatter, S. M. (2012) Myelin-Derived ephrinB3 Restricts Axonal Regeneration and Recovery After Adult CNS Injury. Proc Natl Acad Sci U S A. 109, 5063-5068.

  31. Tang, X. X., Pleasure, D. E., and Ikegaki, N. (1997) CDNA Cloning, Chromosomal Localization, and Expression Pattern of EPLG8, a New Member of the EPLG Gene Family Encoding Ligands of EPH-Related Protein-Tyrosine Kinase Receptors. Genomics. 41, 17-24.

  32. Ricard, J., Salinas, J., Garcia, L., and Liebl, D. J. (2006) EphrinB3 Regulates Cell Proliferation and Survival in Adult Neurogenesis. Mol Cell Neurosci. 31, 713-722.

  33. Conover, J. C., Doetsch, F., Garcia-Verdugo, J. M., Gale, N. W., Yancopoulos, G. D., and Alvarez-Buylla, A. (2000) Disruption of Eph/ephrin Signaling Affects Migration and Proliferation in the Adult Subventricular Zone. Nat Neurosci. 3, 1091-1097.

  34. Yu, G., Luo, H., Wu, Y., and Wu, J. (2003) Mouse ephrinB3 Augments T-Cell Signaling and Responses to T-Cell Receptor Ligation. J Biol Chem. 278, 47209-47216.

  35. Klein, R. (2004) Eph/ephrin Signaling in Morphogenesis, Neural Development and Plasticity. Curr Opin Cell Biol. 16, 580-589.

  36. Liu, X., Hawkes, E., Ishimaru, T., Tran, T., and Sretavan, D. W. (2006) EphB3: An Endogenous Mediator of Adult Axonal Plasticity and Regrowth After CNS Injury. J Neurosci. 26, 3087-3101.

  37. Contractor, A., Rogers, C., Maron, C., Henkemeyer, M., Swanson, G. T., and Heinemann, S. F. (2002) Trans-Synaptic Eph Receptor-Ephrin Signaling in Hippocampal Mossy Fiber LTP. Science. 296, 1864-1869.

  38. Doeppner, T. R., Bretschneider, E., Doehring, M., Segura, I., Senturk, A., Acker-Palmer, A., Hasan, M. R., Elali, A., Hermann, D. M., and Bahr, M. (2011) Enhancement of Endogenous Neurogenesis in Ephrin-B3 Deficient Mice After Transient Focal Cerebral Ischemia. Acta Neuropathol. 122, 429-442.

  39. Flanagan, J. G., and Vanderhaeghen, P. (1998) The Ephrins and Eph Receptors in Neural Development. Annu Rev Neurosci. 21, 309-345.

  40. Furne, C., Ricard, J., Cabrera, J. R., Pays, L., Bethea, J. R., Mehlen, P., and Liebl, D. J. (2009) EphrinB3 is an Anti-Apoptotic Ligand that Inhibits the Dependence Receptor Functions of EphA4 Receptors during Adult Neurogenesis. Biochim Biophys Acta. 1793, 231-238.

  41. Dalva, M. B., Takasu, M. A., Lin, M. Z., Shamah, S. M., Hu, L., Gale, N. W., and Greenberg, M. E. (2000) EphB Receptors Interact with NMDA Receptors and Regulate Excitatory Synapse Formation. Cell. 103, 945-956.

  42. Henkemeyer, M., Itkis, O. S., Ngo, M., Hickmott, P. W., and Ethell, I. M. (2003) Multiple EphB Receptor Tyrosine Kinases Shape Dendritic Spines in the Hippocampus. J Cell Biol. 163, 1313-1326.

  43. Aoto, J., Ting, P., Maghsoodi, B., Xu, N., Henkemeyer, M., and Chen, L. (2007) Postsynaptic ephrinB3 Promotes Shaft Glutamatergic Synapse Formation. J Neurosci. 27, 7508-7519.

  44. Stahl, S., Branca, R. M., Efazat, G., Ruzzene, M., Zhivotovsky, B., Lewensohn, R., Viktorsson, K., and Lehtio, J. (2011) Phosphoproteomic Profiling of NSCLC Cells Reveals that Ephrin B3 Regulates Pro-Survival Signaling through Akt1-Mediated Phosphorylation of the EphA2 Receptor. J Proteome Res. 10, 2566-2578.

  45. Kullander, K., and Klein, R. (2002) Mechanisms and Functions of Eph and Ephrin Signalling. Nat Rev Mol Cell Biol. 3, 475-486.

  46. Holland, S. J., Gale, N. W., Mbamalu, G., Yancopoulos, G. D., Henkemeyer, M., and Pawson, T. (1996) Bidirectional Signalling through the EPH-Family Receptor Nuk and its Transmembrane Ligands. Nature. 383, 722-725.

  47. Kullander, K., Croll, S. D., Zimmer, M., Pan, L., McClain, J., Hughes, V., Zabski, S., DeChiara, T. M., Klein, R., Yancopoulos, G. D., and Gale, N. W. (2001) Ephrin-B3 is the Midline Barrier that Prevents Corticospinal Tract Axons from Recrossing, Allowing for Unilateral Motor Control. Genes Dev. 15, 877-888.

  48. Antion, M. D., Christie, L. A., Bond, A. M., Dalva, M. B., and Contractor, A. (2010) Ephrin-B3 Regulates Glutamate Receptor Signaling at Hippocampal Synapses. Mol Cell Neurosci. 45, 378-388.

  49. Takasu, M. A., Dalva, M. B., Zigmond, R. E., and Greenberg, M. E. (2002) Modulation of NMDA Receptor-Dependent Calcium Influx and Gene Expression through EphB Receptors. Science. 295, 491-495.

  50. Dalva, M. B., McClelland, A. C., and Kayser, M. S. (2007) Cell Adhesion Molecules: Signalling Functions at the Synapse. Nat Rev Neurosci. 8, 206-220.

  51. Yokoyama, N., Romero, M. I., Cowan, C. A., Galvan, P., Helmbacher, F., Charnay, P., Parada, L. F., and Henkemeyer, M. (2001) Forward Signaling Mediated by Ephrin-B3 Prevents Contralateral Corticospinal Axons from Recrossing the Spinal Cord Midline. Neuron. 29, 85-97.

  52. Kullander, K., Butt, S. J., Lebret, J. M., Lundfald, L., Restrepo, C. E., Rydstrom, A., Klein, R., and Kiehn, O. (2003) Role of EphA4 and EphrinB3 in Local Neuronal Circuits that Control Walking. Science. 299, 1889-1892.

  53. Alvarez-Buylla, A., and Garcia-Verdugo, J. M. (2002) Neurogenesis in Adult Subventricular Zone. J Neurosci. 22, 629-634.

  54. Luskin, M. B. (1993) Restricted Proliferation and Migration of Postnatally Generated Neurons Derived from the Forebrain Subventricular Zone. Neuron. 11, 173-189.

  55. Betarbet, R., Zigova, T., Bakay, R. A., and Luskin, M. B. (1996) Dopaminergic and GABAergic Interneurons of the Olfactory Bulb are Derived from the Neonatal Subventricular Zone. Int J Dev Neurosci. 14, 921-930.

  56. Sawamiphak, S., Seidel, S., Essmann, C. L., Wilkinson, G. A., Pitulescu, M. E., Acker, T., and Acker-Palmer, A. (2010) Ephrin-B2 Regulates VEGFR2 Function in Developmental and Tumour Angiogenesis. Nature. 465, 487-491.

  57. Nobes, C. D., and Hall, A. (1995) Rho, Rac and cdc42 GTPases: Regulators of Actin Structures, Cell Adhesion and Motility. Biochem Soc Trans. 23, 456-459.

  58. Fukata, M., Nakagawa, M., and Kaibuchi, K. (2003) Roles of Rho-Family GTPases in Cell Polarisation and Directional Migration. Curr Opin Cell Biol. 15, 590-597.

  59. Negrete, O. A., Levroney, E. L., Aguilar, H. C., Bertolotti-Ciarlet, A., Nazarian, R., Tajyar, S., and Lee, B. (2005) EphrinB2 is the Entry Receptor for Nipah Virus, an Emergent Deadly Paramyxovirus. Nature. 436, 401-405.

  60. Negrete, O. A., Wolf, M. C., Aguilar, H. C., Enterlein, S., Wang, W., Muhlberger, E., Su, S. V., Bertolotti-Ciarlet, A., Flick, R., and Lee, B. (2006) Two Key Residues in ephrinB3 are Critical for its use as an Alternative Receptor for Nipah Virus. PLoS Pathog. 2, e7.

  61. Bonaparte, M. I., Dimitrov, A. S., Bossart, K. N., Crameri, G., Mungall, B. A., Bishop, K. A., Choudhry, V., Dimitrov, D. S., Wang, L. F., Eaton, B. T., and Broder, C. C. (2005) Ephrin-B2 Ligand is a Functional Receptor for Hendra Virus and Nipah Virus. Proc Natl Acad Sci U S A. 102, 10652-10657.

  62. Xu, K., Broder, C. C., and Nikolov, D. B. (2012) Ephrin-B2 and Ephrin-B3 as Functional Henipavirus Receptors. Semin Cell Dev Biol. 23, 116-123.

  63. Xu, K., Rajashankar, K. R., Chan, Y. P., Himanen, J. P., Broder, C. C., and Nikolov, D. B. (2008) Host Cell Recognition by the Henipaviruses: Crystal Structures of the Nipah G Attachment Glycoprotein and its Complex with Ephrin-B3. Proc Natl Acad Sci U S A. 105, 9953-9958.

  64. Restrepo, C. E., Margaryan, G., Borgius, L., Lundfald, L., Sargsyan, D., and Kiehn, O. (2011) Change in the Balance of Excitatory and Inhibitory Midline Fiber Crossing as an Explanation for the Hopping Phenotype in EphA4 Knockout Mice. Eur J Neurosci. 34, 1102-1112.