Phenotypic Mutation 'pioneer'

• Allele: pioneer
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 121,414,595 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Tbk1
• Gene Name: TANK-binding kinase 1
• Synonym(s): 1200008B05Rik
• Chromosomal Location: 121,382,360-121,422,692 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010] ; PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Phenylalanine changed to Isoleucine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9WUN2
• PDB Structure: Crystal structure of mouse TBK1 bound to BX795 [X-RAY DIFFRACTION] ; Crystal structure of mouse TBK1 bound to SU6668 [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000020316; Gene: ENSMUSG00000020115; AA Change: F40I

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	300	2.6e-46	PFAM
Pfam:Pkinase_Tyr	10	250	1.5e-27	PFAM
low complexity region	355	366	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000020316)
• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
  (Using ENSMUST00000219400)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Live Mice, gDNA
• MMRRC Submission: 036776-MU
• Last Updated: 2018-06-13 10:05 AM by Anne Murray
• Record Created: 2012-05-03 10:06 AM by Hexin Shi
• Record Posted: 2012-11-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Hexin Shi, Ying Wang, Bruce Beutler

Accession Number

NCBI RefSeq:NM_019786.4; MGI:1929658

Alleles Listed at MGI

All Mutations and Alleles(26) : Chemically induced (ENU)(1) Gene trapped(18) Targeted(7)

Phenotypic Description

Figure 1. The Pioneer mouse was identified as being defective in immune responses to transfected dsDNA. The red dot denotes the male Pioneer animal identified in the screen.

Peritoneal macrophages isolated from heterozygous Pioneer mice produce reduced amounts of type I interferon (IFN) in response to transfected dsDNA oligonucleotides; the response of the index Pioneer mouse is shown in Figure 1 (Double-stranded DNA Macrophage Screen).  The Pioneer mutation is lethal in homozygous state; 100% of homozygous Pioneer mutants die prenatally.

Nature of Mutation

Figure 2. Mapping results for Pioneer . A binomial probability calculation (concordant vs not concordant). The calculated p (non-linkage) value is 0.000137329102 (16 of 17 red dots are Tbk1 heterozygous). The LOD score was determined to be 3.862.

Sequencing of the candidate gene, Tbk1, identified a T to A transversion at position 277 (in exon 3 of 21 exons) of the mRNA sequence of Tbk1 (NM_019786.4), encoding TBK1. The binomial probability calculation method (see the Genetic Mapping: Whole Genome Mapping and Fine Mapping protocol) was used to verify that Tbk1 was the causitive gene for Pioneer (Figure 2). The calculated p(non-linkage) value was 0.000137329102. The LOD score was determined to be 3.862, indicating that Tbk1 is the causative gene for Pioneer.

259  CTCTATGCTGTCAAAGTATTTAATAACATAAGCTTCCTT 34   -L--Y--A--V--K--V--F--N--N--I--S--F--L-

The mutated nucleotide is indicated in red lettering and causes a phenylalanine to isoleucine substitution at residue 40 of the TBK1 protein.

Protein Prediction

Figure 3. TBK1 domains and crystal structures.  TBK1 has an N-terminal catalytic kinase domain, a ubiquitin-like domain (ULD), and two coiled-coil domains at the C-terminus. The TBK1 C-terminus also includes a leucine zipper and a helix-loop-helix (HLH) domain. The crystal structure on the bottom left represents the kinase domain and ULD of TBK1 that has been crystalized at 2.6Å in the presence of a 3-phosphoinositide-dependent kinase 1 (Pdk1) and TBK1 inhibitor, BX795 (PDB 4EUT).  The crystal structure on the bottom right is of the ULD from human TBK1 (PDB 4EFO).

The serine/threonine kinase TANK-binding kinase 1 (TBK1; alternatively NF-κB-activating kinase (Nak) or tumor necrosis factor receptor (TNFR1)-associated factor 2 (TRAF2)-interacting kinase (T2K)) is an IκB kinase (IKK) homologue [(1;2); reviewed in (3)].  TBK1 is highly conserved and mouse TBK1 is 94% identical to human TBK1 (2). TBK1 is 64% homologous to another IKK homologue, IKKi (or IKK-ε) (2;4-6), and both are essential for interferon-regulatory factor (IRF) 3 and IRF7 activation leading to type I IFN induction following viral infection or after LPS exposure (7-10). TBK1 and IKKi share ~30% sequence identity with IKKα and IKKβ within the kinase domains (4;11). Although TBK1 and IKKi share sequence similarities with IKKα and IKKβ, TBK1 and IKKi differ from them in several aspects (12).  (i) In vitro overexpression of both TBK1 and IKKi activates NF-κB and induces the phosphorylation of IκBα [(1-5); reviewed in (13)].  In contrast to IKKβ, which phosphorylates IκBα at Ser32 and Ser36, TBK1 and IKKi only phosphorylate IκBα at Ser36. Thus, NF-κB activation by TBK1 and IKKi does not occur by release from IκB sequestration, as occurs in the canonical NF-κB pathway and depends on phosphorylation on both Ser32 and Ser36 of IκB (see “Background” for more information on TBK1-mediated NF-κB activation). (ii) IKKα and IKKβ have a canonical activation loop motif similar to that of mitogen-activated protein kinase kinase (MAPKK) (Ser-X-X-X-Ser), where phosphorylation of one or both Ser residues results in kinase activation.  In the activation loops of both TBK1 and IKKi, the first Ser is replaced by Glu (Glu-X-X-X-Ser), and phosphorylation of the Ser is necessary for kinase activation (4;11;12).  (iii) IKKi mRNA is inducible upon exposure to cytokines and LPS; IKKβ is not (4).

Both TBK1 and IKKi have similar protein domains: an N-terminal catalytic kinase domain, a ubiquitin-like domain (ULD), and two coiled-coil domains at the C-terminus [Figure 3; (2;14-16)]. The C-terminus of TBK1 has also been referred to as a scaffolding/dimerization domain (SDD) (17).  The topology of the TBK1 and IKKi C-terminus is reported to also include a leucine zipper and a helix-loop-helix (HLH) (4;11;12). In IKKα and IKKβ, the HLH region regulates the kinase activity and a similar activity is proposed for the HLH domain of TBK1 [(18;19); reviewed in (20)].

The kinase domain of TBK1 [aa 1-234 (16); aa 1-297 (15)] mediates the phosphorylation of several TBK1 substrates including IFN-regulatory factor 3 (IRF3) and IRF7 (see record for inept) (16) (Table 1). A TBK1 protein with a mutation at the essential phosphoserine within the activation loop (Ser172Ala) lost all kinase activity. TBK1 with a Ser172Glu mutation had some activity, although it was reduced >100 fold compared to the wild-type TBK1; the K_m for both ATP and IκBα were not changed, indicating that the change in TBK1 activity was due to the rate of catalysis, not a change in substrate binding (12).

Table 1.  TBK1 substrates

TBK1 substrate	Substrate description	Refs
IRF3, IRF7, and IRF5	Transcription factors that promote IFN production	(21-26)
Ddx3x	DEAD box RNA helicase that promotes IFNβ transcription in an innate antiviral response	(27;28)
Tank	Scaffold protein that promotes NF-κB activation and IRF7 activation	(2;15;23;29)
Insulin Receptor (IR)	Tetrameric receptor essential for insulin signaling and action; negatively regulated by TBK1	(30)
Akt	Serine/Threonine kinase activated by infection by viruses; poly(I:C) and LPS induce TBK1-dependent, PI3K-independent phosphorylation of Akt; Akt induces IRF3 activation and IFN-β expression	(31;32)
NF-κB (p65 subunit)	Transcription factor involved in regulating apoptotic and immune/inflammation genes	(1;2;33-35)
cIAP1 & cIAP2	E3 ligases that associate with TRAF1 and TRAF2; function in the TNFR1 and IRF pathways	(36;37)
Tax1bp1	Ub-binding protein that suppresses TNFR1 signaling	(38;39)
IKKβ	Kinase that induces IκB degradation and NF-κB activation in response to growth factors that simulate protein kinase C-ε (PKCε) activity	(11)
IκBα	Kinase that sequesters NF-κB in the cytoplasm	(2;4;6;12;33-35)
STING	Adaptor activated by cytoplasmic DNA receptors and receptor for c-di-GMP	(40)
DAI (also DLM-1/ZBP1)	Intracellular DNA sensor that facilitates the induction of type I interferons; phosphorylation amplifies the recruitment of additional TBK1 and IRF3	(41)

The ULD in mouse TBK1 (aa 305-383) and IKKi are 65% similar (14). The ULD is essential for TBK1 and IKKi kinase activity as well as for substrate (e.g., IRF3 and IRF7) recognition [(14); reviewed in (15;42)]. Analysis of ULD deletion mutants revealed that the ULD is required for the regulation of IFN-inducible gene transcription in response to lipopolysaccharide (LPS) and polyinosinic-polycytidylic acid (poly(I:C), a dsRNA mimic) (14). TBK1 can be activated by IKKβ, in the presence of ATP, and by autophosphorylation (17;43); deletion of the ULD prevents TBK1 autophosphorylation (14).  The kinase domain and ULD have been crystalized at 2.6Å in the presence of a 3-phosphoinositide-dependent kinase 1 (Pdk1) and TBK1 inhibitor, BX795 [Figure 2 (left); PDB 4EUT; (17)].  Characterization of this construct found that the ULD is adjacent to the C-terminal lobe of the kinase domain and both the kinase domain and the ULD are in proximity to interact with the SDD (17). Another study solved the crystal structure of the ULD from human TBK1 [Figure 2 (right); PDB 4EFO; (44)].  Analysis of the structure found that the TBK1 ULD has several hydrophobic conserved residues that are found in ubiquitin, IKKα, and IKKβ (44).  It is proposed that these hydrophobic residues facilitate the binding between the ULD and the C-terminal HLH (44). 

TBK1 and IKKi share two coiled-coil domains at the C-terminus [aa 603-650, 679-712; (2) or aa 619-657, 682-713; (15)].  The C-terminal 42 amino acids of TBK1 (part of coiled-coil domain 2) associate with the scaffold proteins TANK, SINTBAD, and NAP1 (see the “Background” section for more details about these, and other, scaffold proteins) (2;15).  This region of TBK1 is also essential for TANK-dependent binding of TRAF2, an activator of NF-κB signaling downstream of TNF receptor superfamily proteins (2). Deletions or mutations of the second coiled-coil domain (aa 682-713) result in an inactive protein that cannot be activated by stimuli (e.g. poly(I:C)) (15). The coiled-coiled domains of IKKα and IKKβ are proposed to mediate homo- and heterodimeric interactions between the two proteins [(18;45); reviewed in (6)]; this function has not been examined in TBK1.

K63-linked ubiquitinylation of TBK1 is essential for the activation of innate antiviral immune responses and links NF-κB essential modulator (NEMO; also IKKγ, see the record for panr2) to TBK1 (46;47)]. TBK1 is polyubiquitinylated with K63-linked ubiquitin chains by E3 ligases Mind bomb 1 (MIB1) and MIB2, a modification that promotes production of IFNs following stimulation with dsRNA and RNA viruses (17;48).  Nrdp1, an E3 ligase, also ubiquitinylates TBK1 in hematopoietic cells following exposure to LPS, promoting IRF3 activation (49).  In Traf3^-/- mouse embryonic fibroblasts (MEFs), K63-linked polyubiquitinylation of TBK1 was reduced, indicating that TRAF3 is essential for this post-translational modification (39).  It is unknown if TRAF3 directly ubiquitinylates TBK1 or acts as an adaptor for another E3 ligase (e.g., Nrdp1, MIB1, or MIB2).

The Pioneer mutation results in a phenylalanine to isoleucine substitution at residue 40.  Phe40 is within the kinase domain of TBK1.

Expression/Localization

Northern blot analysis of mouse tissues detected a 3.3 kb Tbk1 transcript in small intestine, lung, stomach, testis, brain, skin, kidney, heart, spleen, liver, and thymus; i.e., Tbk1 is expressed ubiquitously (2).  A separate study of human tissues confirmed ubiquitous expression of TBK1, with highest expression in the testis (11).  In contrast, Ikbke, encoding IKKi, is highly expressed in spleen, peripheral blood leukocytes, thymus, pancreas, and placenta; i.e.,  predominantly in cells of the immune system. IKKi is expressed at lower levels in the lung, prostate, kidney, ovary, and colon (4).  IKKi expression can be induced in non-hematopoietic cells upon stimulation with TNF, phorbol esters (PMA), LPS, and by virus infection [(4;7;50); reviewed in (3)].

Upon Toll-like Receptor 3 (TLR3) stimulation, the distribution of TBK1 changes from membrane-associated structures to a diffuse pattern in the cytoplasm with some endosomal colocalization (51).  Further studies found that TBK1 relocalized to vesicular structures that contain STING and the autophagosome marker autophagy-related gene 9a (Atg9a) (see “Background” for more details on the relationship between TBK1 and Atg9a) [(52); reviewed in (15)].

Deng and colleagues have determined that TBK1 is alternatively spliced to a form (TBK1s) that lacks exons 3-6 of TBK1 (16).  Translation of TBK1s is initiated from the second ATG and, as a result, the exons that encode the kinase domain of full-length TBK1 are deleted. Upon infection with Sendai virus (SeV), RT-PCR of TBK1 in bone marrow-derived dendritic cells (BMDCs) revealed two cDNA species: 2190 bp (full-length TBK1) and 1567 bp (TBK1s) (16). Protein analysis of SeV-infected BMDCs indicates that TBK1s is a 55-kDa protein (in comparison to the 75-kDa TBK1 protein) (16).  Western blot analysis of the TBK1s protein product determined that the highest level of protein was found in brain, kidney, heart, thymus, and lymph node (16). In the heart and kidney, the TBK1s protein was more abundant than the TBK1 protein (16). Examination of the possible function of TBK1s found that TBK1s inhibits IFNβ promoter activity following SeV infection resulting in negative regulation of IFNβ signaling (16).  SeV-induced NF-κB activation was slightly increased by TBK1s.  TBK1s also inhibited activation of the IFNβ promoter induced by overexpression of retinoic acid-inducible gene I (RIG-I; see “Background” for more details on RIG-I) (16), but not mitochondrial antiviral signaling adapter (MAVS; also known as IPS-1, VISA, or Cardif) or TBK1 (16).  Further analysis revealed that TBK1s interacts with the caspase activation and recruitment domains (CARDs) of RIG-I, preventing RIG-I from interacting with MAVS to propagate downstream signaling leading to induction of type I IFN; an interaction between full-length TBK1 and RIG-I was not detected (16).  Taken together, these findings indicate that TBK1s interrupts the endogenous interaction of RIG-I with MAVS, blocking SeV-triggered IFN-signaling (16).

Background

Figure 4.  TBK1 functions in type-I IFN production after nucleic acid sensing.  Activation of TLRs either at the endosome or on the cell surface leads to the production of type I IFN via transcriptional activation by IRF3 and IRF7.  The cytoplasmic NOD receptors can also induce type I IFN production in response to bacterial cell wall components via activation of the kinase RICK and downstream signaling molecules including NF-κB and TBK-1. Several intracellular nucleic acid sensors (e.g., DAI, RIG-I, MDA5, DDX41, and IFI16) are involved in TBK1-associated activation of IRF3. RIG-I and MDA5 are activated following exposure to dsRNA via an association with MAVS, which can further associate with STING to activate IRF3.  DAI, IFI16, and DDX41 recognize dsDNA to facilitate a STING-mediated activation of TBK1.  STING-mediated sensing of cyclic-di-GMP, a bacterial second messenger can lead to enhanced recruitment of TBK1 and the enhanced expression of type I IFNs. Figure adapted from Trinchieri,G. 2010. JEM; 207(10):2053-2063.

TBK1 and the production of type-I IFNs through the IRFs

TBK1 and IKKi play an important role in the induction of type I IFNs in response to activation of several sensors of nucleic acids, primarily in the context of viral infection.  The function of the kinases centers on the phosphorylation of several IRF transcription factors, which coordinate the expression of type I IFNs.  The type I IFNs bind to IFNαβ receptors on neighboring cells, facilitating the production of IFN-stimulated genes that function in growth inhibition and apoptosis as well as in the maturation of antigen presenting cells (APCs) and the activation of CD8⁺ T cells, B cells, and NK cells (53). The function of TBK1 in propagating signals from each nucleic acid sensor is described below and shown in Figure 4.

TLRs

Figure 5. (Left) Overview of endosomal Toll-like receptor (TLR) signaling pathways activated up nucleic acid sensing and (right) RIG-I signaling. Shown on the right are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN. TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. In the MyD88-dependent pathway, MyD88 (lime green) recruits IRAK kinases. TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, resulting in IκB ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus. Activation of TLR7 and 9 recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN. In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3. TBK1 can induce the polyubiquitinylation of IRF3, subsequently leading to the degradation of IRF3. TBK1 is itself targeted for proteasome-mediated degradation by NLRP4, a Nod-like receptor family protein that recruits the E3 ubiquitin ligase DTX4 to TBK1. (Left) RIG-I signaling. 5′-triphosphorylated RNA from DNA (RNA pol III facilitates the conversion of the DNA to RNA) or RNA viruses binds to RIG-I, causing it to release autoinhibitory interactions. CARD-CARD interactions between RIG-I and MAVS lead to MAVS activation, which involves a switch to the prion-like conformation and aggregation into large polymers. These polymers activate TRAF6 and TRAF3, leading to NF-κB-, IRF3- and IRF-7 dependent gene transcription through the TBK1-SINTBAD-NAP1-TANK complex. Phosphorylation events are represented by small yellow circles labeled with a “P”.

The TLRs serve as the major microbe-sensing system in mammals, each TLR detecting one or more specific microbe-derived molecule (Figure 5, left).  A subset of TLRs comprised of TLR3, TLR7, TLR8, and TLR9 detects nucleic acid ligands, and therefore plays an important role in the sensing of viruses.  TLR3 detects poly I:C, a double-stranded RNA analog; TLR7 detects single-stranded RNA and its synthetic imidazoquinoline analogs resiquimod, imiquimod, and loxoribine; TLR8 detects a combination of polyT oligodeoxynucleotides and a synthetic imidazoquinoline agonist; and TLR9 detects unmethylated DNA and CpG-oligodeoxynucleotides (CpG-DNA).  Activation of TLR3, TLR7, or TLR9 leads to the production of proinflammatory cytokines via transcriptional activation by NF-κB, and the antiviral cytokine type I IFN via transcriptional activation by IRF3 and IRF7.

TBK1 and IKKi play an essential role in the induction of type I IFN downstream of TLR3.  TLR3 signaling is mediated solely by the adaptor protein TRIF, which assembles a signaling complex containing TRAF3, TBK1, IKKi, and IRF3 and/or IRF7.  TBK1 and IKKi phosphorylate serine residues within the C-terminal domains of the IRFs (8;54); evidence indicates that TBK1 and IKKi target the same residues within each IRF and therefore perform redundant functions in this capacity (7;8;54).  However, unique roles for TBK1 and IKKi are supported by the finding that knockout of TBK1 in mice is more detrimental to virus- or poly(I:C)-induced IFN production than knockout of IKKi [(7); reviewed in (15)], and DNA virus-dependent IFN responses depend exclusively on TBK1 [(53); reviewed in (15)].  Phosphorylation of IRF3 and IRF7, which normally reside in the cytoplasm as monomers, results in their homo- or heterodimerization, permitting them to translocate to the nucleus, associate with coactivators [e.g., IRF3 interacts with CBP-p300 (8)], and bind to interferon stimulated response elements (ISREs) in the promoters of target genes [e.g., Ifnb1 (i.e., IFNβ), Ccl5 (i.e., RANTES (regulated on activation normal T cell expressed and secreted)), IL-15, and Cxcl10 (i.e., IP-10)] [(21-23;51;53;55); reviewed in (42)]. In response to lipopolysaccharide (LPS), TLR4 also signals via TRIF, TRAF3, and TBK1 to activate IRF3 and IRF7, and induce type I IFN (56;57).

TLR3-dependent induction of IFN-α/β and/or IFN-λ is essential to mount an immune response to herpes simplex virus-1 (HSV-1) in the central nervous system.  Mutations in UNC-93B, TLR3, TRIF, or TRAF3 have been shown to result in herpes simplex encephalitis (HSE; OMIM: #610551), a lethal central nervous system disease that occurs during primary infection with the double-stranded DNA virus HSV-1.  Herman et al. have examined two patients with HSE with heterozygous autosomal dominant missense mutations in TBK1 (58). One patient had a G159A mutation near the activation loop; the other patient had a D50A mutation within the kinase domain (58). The G159A mutation did not alter the expression of TBK1, but D50A resulted in reduced expression of both the TBK1 mRNA and protein, indicating that it is a loss-of-expression allele.  Examination of TBK1 enzymatic activity determined that the G159A mutant was kinase-dead. Transfection of either G159A or D50A mutants in Tbk1^-/- MEFs could not restore IFN-β expression following exposure to poly(I:C) (58).  Examination of dermal fibroblasts from the G159A patient found that IRF3 phosphorylation and dimerization were reduced when compared to normal levels (58).  In addition, the G159A mutant fibroblasts did not produce IFN-β or IFN-λ upon poly(I:C) stimulation (58). On the other hand, fibroblasts from the D50A patient responded normally to poly(I:C) and IRF3 dimerization was only slightly reduced (56).  Herman et al. concluded that the G159A mutation results in a dominant-negative effect on the normal copy of TBK1, while the effects observed as a result of the D50A mutation are due to haploinsufficiency (58).  These findings demonstrate that TBK1 is necessary for TLR3-dependent control of HSV-1 in the central nervous system.

In contrast to TLR3 signaling, the induction of type I IFN in response to TLR7 activation requires the adaptor MyD88, which signals through IRAK1 and TRAF6 to induce type I IFNs (26;57).  In this pathway, TBK1 and IKKi phosphorylate IRF5 and IRF7, leading to type I IFN induction (26;57).  The activation of TLR9 also results in production of type I IFN; however, TBK1 is not required (57).

TBK1 contributes to the negative regulation of type I IFN signaling following viral infection.  TBK1 induces the polyubiquitinylation of IRF3 by a Cullin-based E3 ubiquitin ligase; IRF3 is subsequently degraded (55).  TBK1 is itself targeted for proteasome-mediated degradation by NLRP4, a Nod-like receptor family protein (59) that recruits the E3 ubiquitin ligase DTX4 to TBK1.  DTX4 modifies TBK1 by the addition of K48-linked ubiquitin chains, resulting in the degradation of TBK1 and downregulation of IFN signaling.  Finally, TBK1 is negatively regulated by the phosphatase SHIP-1; TBK1 is hyperphosphorylated and TLR3-dependent type I IFN production is increased in SHIP-1-deficient macrophages (51).

RIG-I

Viral infection also activates innate immune responses in part through RIG-I, a cytoplasmic sensor of 5’-triphosphorylated and uncapped ssRNA or dsRNA (Figure 4 & Figure 5, right).  RIG-I signaling requires MAVS, a mitochondria-localized adapter that links RIG-I to transcriptional activation by NF-κB and IRF3 (see “Expression/Localization” section, above) (60-62).  MAVS associates with additional adaptor proteins (e.g., RIP1, MITA/STING, and WDR5) to activate IRF3 and NF-κB (40;63). NEMO, a downstream factor in RIG-I signaling, interacts with TANK to recruit TBK1 and IKKi to the RIG-I-MAVS complex to phosphorylate IRF3.  RIG-I activates NF-κB via TRAF6 and the IKK complex (3;64;65).

DAI, DDX41, IFI16, and STING

The production of type I IFNs in response to sensing of cytosolic dsDNA also depends on TBK1 and IRF3.  Several molecules have been proposed as cytosolic DNA sensors (Figure 4).  First, DAI (DNA-dependent activator of IFN-regulatory factors; also DLM-1/ZBP1) was shown to bind to dsDNA, leading to association with TBK1 and IRF3 and induction of type I IFN [(66;67); reviewed in (68)]. However, examination of MEFs, bone-marrow dendritic cells, lung epithelial cells, and macrophages after knockout of DAI found that all responded to B-DNA, plasmid DNA, DNA vaccines, and DNA virus infection by producing normal amounts of type I IFN (69;70).  Knockdown of DAI in several human cell types also had no effect on type I IFN production in response to poly(dA-dT) or intracellular bacterial infection (70). Thus, DAI may have a redundant role in sensing cytosolic DNA (41;69).

DDX41, a DEXDc helicase, has been shown to be a sensor of intracellular DNA in myeloid dendritic cells (mDCs) (71).  Knockdown of DDX41 by short hairpin RNA inhibited the ability of the mDCs to stimulate the induction of type I interferon or cytokine responses to DNA and DNA viruses (71). Furthermore, knockdown of DDX41 blocked the activation of TBK1 and NF-κB and IRF3 by B-form DNA (71).  IFI16 also depends upon TBK1 and IRF3 for type I IFN responses to transfected viral DNA (72). RNA-mediated interference of IFI16 inhibits the DNA- and herpes simplex virus type 1 (HSV-1)-induced activation of IRF3 and NF-κB (72). Comparison of intracellular DNA-induced type I IFN production after knockdown of either IFI16 or DDX41 in mDCs and bone marrow-derived DCs revealed that DDX41 is more vital in the initial sensing of B-form DNA (71).  Zhang et al. suggest that DDX41 and IFI16 have complementary roles in sensing intracellular DNA and that IFI16 is important in the amplification phase of the IFN response to DNA (71).

The adapter proteins MAVS and STING (stimulator of IFN genes) are also recruited to the TBK1-IRF3 complex formed in response to dsDNA stimulation (66;71-74).  dsDNA induces STING to translocate from the endoplasmic reticulum to the Golgi, and assemble with TBK1 in punctate cytoplasmic structures (52;75).  Interestingly, the exocyst component Sec5 (75), and the autophagy-related proteins Atg9a and LC3 (52) colocalized with STING and TBK1 in response to dsDNA stimulation.  Atg9a deficiency enhanced the translocation of STING from the Golgi to the cytoplasmic structures and the assembly of STING and TBK1 induced by dsDNA, leading to aberrant activation of the innate immune response.  STING can also localize to the outer mitochondrial membrane (40). 

In addition to its role as an adaptor protein in signaling from nucleic acid sensors, STING appears to be a sensor for cyclic diguanylate monophosphate (c-di-GMP) (76-79), a bacterial second messenger that regulates virulence, motility and biofilm formation (80-84). C-di-GMP is a immunostimulator that induces the expression of type I interferons (81;85;86).  STING directly binds c-di-GMP, but not GTP or ATP, and this binding results in enhanced recruitment of TBK1 (78).

TBK1 and NF-κB signaling

The Rel subunits of NF-κB (p65/p50) are sequestered in the cytoplasm by IκB proteins (IκBα, IκBβ, or IκBε). NF-κB is translocated to the nucleus to activate target genes only after the IκB proteins are phosphorylated by the IKK complex (composed of IKKα, IKKβ, and NEMO), ubiquitinylated, and degraded. Although homologous to the classical IKK proteins IKKα and IKKβ, TBK1 is unable to activate NF-κB through IκBα phosphorylation, as mentioned above (Protein Prediction).  Instead, TBK1 was found to directly phosphorylate the transactivation domain of NF-κB, promoting NF-κB nuclear accumulation (34;35).  A TBK1 interactor called NAP1 was shown to activate TBK1 and promote TBK1 phosphorylation of the NF-κB transactivation domain (87).   In further support of a positive role for TBK1 in the regulation of NF-κB, Tbk1^-/- mice exhibit a phenotype strikingly similar to that of IKKβ-, NEMO-, and p65-deficient mice, dying prenatally from liver degeneration and apoptosis (1).  The embryonic lethality of Tbk1^-/- mice was rescued by knockout of TNFR1.  Despite these findings, several other publications reported that TBK1 was dispensable for NF-κB activation in several cell types and in response to several distinct stimuli.  Notably, NF-κB displayed normal DNA binding activity and/or transcriptional activity in TNF-α-stimulated fibroblasts from Tbk1^-/- embryos (1;7;8).  In another study, Clark et al. used a IKKi/TBK1 inhibitor, MRT67307, and found that TBK1/IKKi negatively regulate the IKKs in macrophages following stimulation of the TNFR and TLR signaling pathways (43).  Findings from several studies pertaining to the role of TBK1 in NF-κB activation are summarized in Table 2.  

Table 2.  TBK1 and NF-κB

Reference	Model	Stimulus	Findings
Pomerantz et al. (2)	TBK1 overexpression	None	Induction of p50:p65 DNA-binding activity and stimulation of the NF-κB promoter; TBK1 is required for TANK-mediated activation of NF-κB
	Dominant-negative TBK1	TNF-α, IL-1, CD-40L, or LPS	No change in NF-κB activation; TBK1-dependent role of TANK in NF-κB activation functions in distinct pathway that converges with TBK1-independent pathways at the level of TRAFs
Bonnard et al. (1)	Tbk1-/- MEFs	TNF-α or IL-1	Normal degradation of I-κB and NF-κB binding activity; NF-κB-mediated transcription reduced
Fujita et al. (87)	TBK1 overexpression	TNF-α or PMA	TBK1 phosphorylates Ser536 on p65; TBK1-NAP1 is essential for NF- κB-mediated transcription; NAP1 deletion impairs NF-κB and promotes TNF- α-induced apoptosis
Clark et al. (43)	MRT67307-treated macrophages	Poly(I:C) or LPS	Increased p105 and RelA phosphorylation; enhanced NF-κB transcriptional activity
		TNF-α	NF-κB-dependent gene transcription enhanced
Hemmi et al. (7)	Tbk1-/- MEFs	LPS	NF-κB binding activity comparable to wild-type
		Poly(I:C)	No change in NF-κB DNA binding activity
		TNF-α	NF-κB binding activity comparable to wild-type
McWhirter et al. (8)	Tbk1-/- MEFs	Virus, poly(I:C), or LPS	TBK1 is not required for NF-κB activation
		TNF-α	No change in NF-κB dependent gene transcription

TBK1 adaptor proteins

TBK1 interacts with several proteins to mediate NF-κB, IRF3, and IRF7 signaling through both TLR-dependent and TLR-independent pathways [(88); reviewed in (15;42)] (Table 3).

Table 3.  TBK1 interacting proteins

Protein Name	Brief Description	Refs
Tank	Scaffold protein that promotes IRF3 and IRF7 activation by TBK1 and IKKi	(2;15;23;29;74;89;90)
NAK-associated protein 1 (Nap1)	Regulatory subunit of the IKKi-TBK1 complex; also in a complex with TICAM-1	(87;91;92)
SINTBAD	TBK1 and IKKi adaptor protein necessary for IRF-dependent transcription	(93)
Hsp90	Stabilizes TBK1; forms complex with TBK1 and IRF3 to facilitate signal transduction	(94)
TNFR1-associated death domain protein (TRADD)	TNF receptor adaptor that forms TBK1 complex to facilitate IRF3 and NF-κB signaling	(95;96)
Fas-associated protein with death domain (FADD)	Apoptotic adaptor that can facilitate IRF3 activation upon virus infection	(97)
TRAF3	Connects TRIF to TBK1; essential for polyubiquitinylation of TBK1	(13;39;98)
NEMO	Interaction via TANK	(99)
Tax1bp1 and A20	Inhibit polyubiquitinylation of TBK1 via blocking TRAF3-mediated ubiquitinylation; blocks TBK1-mediated activation of ISREs	(39)
SH2 domain-containing inositol 5'-phosphatase 1 (SHIP-1)	Negatively regulates TLR3-mediated IFNβ production by targeting TBK1/TRAF3/TRIF complex formation	(51)
STING	Regulates IFN production in response to dsDNA	(52;100))
Atg9a	Regulates dsDNA-mediated immune response by assembling with TBK1 and STING	(52)

The Tank-Nap1-SINTBAD-TBK1 complex

Tank (or TRAF-interacting protein (I-TRAF)) acts as a scaffold protein to connect the TBK1/IKKi complex to IRF7 to facilitate IRF7 phosphorylation (and subsequent activation) downstream of TRAF3 [Figure 5, right; (23)].  TANK also functions as a TRAF binding protein that can activate NF-κB through an interaction with TBK1 (but see “TBK1 and NF-κB signaling” above) (2;101). TBK1 and IKKi mediate Lys63-linked, non-degradative polyubiquitinylation of TANK in response to TLR4 activation [(23); reviewed in (42)], as well as SUMOylation of TANK in response to TLR7 activation (102). Nap1 (87) and SINTBAD (93) also interact with TBK1 and IKKi.  Nap1-TBK1 association leads to an increase in TBK1 kinase activity and subsequent phosphorylation of p65 and NF-κB activation (9). SINTBAD shares a conserved TBK1- and IKKi-binding domain (TBD) with Tank and Nap1 [(93); reviewed in (42)].

Recently, the dynamics of the Nap1-SINTBAD-Tank-TBK1 complexes were examined.  Copurification of the proteins found that Nap1, SINTBAD, and Tank did not associate with each other and that the adaptor proteins form distinct complexes with TBK1 (and IKKi); these complexes are localized to different subcellular compartments (15). It is proposed that by binding to the different scaffolding proteins, TBK1 is anchored to different subcellular compartments, facilitating the multi-functionality of TBK1 (15).

Additional functions of TBK1

Cell survival, proliferation, and differentiation

Knockout studies have shown that TBK1 is essential for cell survival (see “Mouse models of TBK1” for more details) (1). siRNA-mediated knockdown of TBK1 revealed that cells with reduced amounts of TBK1 participated in an asynchronous apoptotic program (i.e., 25% of the cells were positive for apoptotic markers at one time); most cells were dead by 150 hours post-siRNA transfection [(103); reviewed in (104)].  Another RNA interference study showed that knockdown of TBK1 promoted TNF-induced apoptosis, probably as a result of impaired NF-κB activation (87).  In support of this idea, a recent study found that phosphorylation of p65 by TBK1 resulted in the expression of plasminogen activator inhibitor-2 (PAI-2), an antiapoptotic member of the serpin family (105).  In TNF-stimulated cells, PAI-2 can maintain cell survival through the protein modifier trans-glutaminase 2 (TG2), an enzyme that cross-links procaspase-3 into inactive dimers and thereby limits caspase 3 activation (105). 

TBK1 directly phosphorylates Akt (32), a serine/threonine kinase that is activated in several cellular processes (e.g., cell survival and proliferation) as well as in the regulation of pathological conditions.  Akt may contribute to IRF3 activation by TBK1 in response to TLR3 and TLR4 stimulation (31).  TBK1 can also regulate the phosphorylation and degradation of p27^kip1, a cell cycle inhibitor (106). As p27 can be phosphorylated by Akt (107), it is proposed that TBK1-mediated phosphorylation and degradation of p27 is via TBK1-activated Akt (31). 

Immunoglobulin class switching is a B cell differentiation process that occurs following activation by an antigen.  A B cell conditional Tbk1 knockout mouse (Tbk1-BKO) was generated to examine the role of TBK1 in regulating humoral immune responses (108).  The Tbk1-BKO mouse had increased production of antigen-specific IgA when exposed to T cell-dependent (NP-KLH), T cell-independent type 1 (NP-LPS), or T cell-independent type 2 (NP-Ficoll) antigens (108).  In addition, the mice produced significantly more antigen-specific IgA and autoantibodies than the wild-type cohorts; production of other isotypes was not significantly changed (108). Further examination determined that the Tbk1-BKO mice had more IgA⁺ B cells in the spleen, mesenteric lymph nodes, and Peyer’s patches.  The percentages of Tbk1-BKO IgA⁺ B cells induced by anti-CD40 (22.38% versus 12.51%) and BAFF (23.43% versus 11.89%) were increased compared to wild type cells as measured by flow cytometry; induction was not increased upon stimulation with TGF-β (108). NIK, a NF-κB-inducing kinase in the noncanonical NF-κB pathway upstream of IKKα, induces the processing of the NF-κB precursor p100 to the p52 subunit and is a cytoplasmic inhibitor of NF-κB (108). Using the Tbk1-BKO mouse, Jin et al. found that TBK1 mediates phosphorylation-dependent degradation of NIK (108). Taken together, these findings indicate that TBK1-mediated phosphorylation and degradation of NIK is a negative mechanism to prevent aberrant noncanonical activation of NF-κB and IgA class switching in B cells stimulated by anti-CD40 or BAFF.

Oncogenesis & Angiogenesis

TBK1 was constitutively activated in several cancer cell lines, and was required for Ras-mediated oncogenic transformation of MEFs (103).  TBK1 has been identified in a complex containing RalB, a Ras-like GTPase that promotes tumor cell survival by blocking apoptosis checkpoint activation, and Sec5, a component of the exocyst complex (103).  TBK1 kinase activation occured within the RalB/Sec5 complex, but it is not known whether TBK1 subsequently activates IRF3 or IRF7 to induce pro-survival proteins.  Interestingly, RalB and Sec5 appear to participate in TBK1-dependent innate immune signaling, as they were necessary for IRF3 translocation to the nucleus in response to TLR3 activation in human bronchial epithelial cells (103).  In addition, Sec5 was required for dsRNA- and Sendai virus-induced IFN-β production by human bronchial epithelial cells.

TBK1 induced the proliferation of human umbilical vein endothelial cells (HUVEC) cells (109).  In addition, transfection of TBK1 in MCF-7, PC3, and KB3-1 cancer cell lines produced supernatants that could promote endothelial cell proliferation (109).  Gene expression analysis of TBK1-transfected HEK293 cells found that several proliferation-promoting secreted factors (e.g. RANTES and IL-8) were up-regulated; angiogenic factors (e.g. Cxcl10, Cxcl11, and Ifnβ) were also upregulated [(109); reviewed in (104)].  It was proposed that TBK1-mediated activation of IRF3 led to a pro-angiogenic phenotype (109).  Hypoxic conditions, a known inducer of angiogenesis, led to an enhanced expression of TBK1 (109). 

Mouse models examining the function of TBK1

Studies have generated knockout mouse models to examine the function of TBK1. Results from several studies are summarized in Table 4. 

Table 4. Summary of findings from TBK1 animal models

Reference	Genotype	Cell type (if applicable)	Conclusion(s)
Bonnard et al. (1)	Tbk1-/-	MEFs	Tbk1-/- mice embryonic lethal by E14.5 due to TNFα-induced apoptosis in the liver TBK1 is recruited to the TNFR1 complex following activation by TNFα to mediate RANTES production TBK1 plays a novel role in the activation of NF-κB-dependent transcription, independently of I-κBα phosphorylation and κB DNA binding
	Tbk1-/-/Tnfr1-/-
McWhirter et al.  (8)	Tbk1-/-	MEFs	TBK1 is required for IRF3 activation and translocation to the nucleus after viral infection
Hemmi et al. (7)	Tbk1-/-	MEFs	TBK1 is required for LPS-, poly(I:C)- and virus-induced IFNβ expression and IRF3 dimerization No change in  NF-κB DNA binding activity
Matsui et al. (110)	Tbk1-/-/Tnf-/-/IKKi-/-	cDCs	TBK1 controls the LPS-induced expression of various IFN-α genes TBK1 (and IKKi) are responsible for the RNA virus-induced production of IFNs, and IFN-inducible genes in cDCs but not in pDCs TBK1 is essential for RIG-I/MDA5-dependent IFN-induction in addition to their role in the TLR signaling TBK1 is not requisite for NF- κB activation
	Tbk1-/-/Tnf-/-
Miyahira et al. (53)	Tbk1-/-/Tnfr1-/-	Macrophages	TBK1 is required for IFN expression in response to DNA (but not RNA) viruses, B-DNA, and TLR4 stimulation There is a functional difference between TBK1 and IKKi in regards to IFN responses to DNA viruses
Marchlik et al. (111)	Tbk1Δ/Δ (inactive allele)	N/A	Increase in circulating monocytes indicates that there is an increase in immune cell activation via co-stimulation of T cells by APCs Lack of TBK1 activity results in deficiency in IRF3 and IFN-β function Tbk1 deficiency causes an increased susceptibility to LPS-induced lethality
Yu et al. (112)	Tbk1-/-/Tnf-/-	Hepatocytes	Hepatitis C Virus RNA-dependent RNA polymerase-induced IRF3 activation is TBK1-dependent TBK1 is required for cytokine production (type I IFN and IL-6) induced by HCV RNA-dependent RNA polymerase
Jin et al. (108)	Tbk1-BKO	B cells	TBK1-mediated phosphorylation and degradation of NIK is a negative mechanism to prevent aberrant noncanonical activation of NF-κB and IgA class switching in B cells stimulated by anti-CD40 or BAFF

Collectively, the TBK1 mouse studies determined that knockout of Tbk1 expression is embryonic lethal by embryonic (E) day 14.5 (1;7;110;111).  However, the knockout animals are viable when crossed to either TNF (7;110;112) or TNFR (1;53) deficient animals.  Bonnard et al. determined that TBK1 is recruited to the TNFR1 complex following activation by TNFα and postulated that the animals do not survive due to TNFα-induced apoptosis of the liver (1).  Also, the Tbk1^-/-  mouse studies determined that TBK1 is required for IRF3 activation and translocation to the nucleus (7;8;112). Further studies determined that in cDCs (110) and hepatocytes (112), TBK1 is required for RNA virus-induced production of IFNs.  In contrast, in pDCs (110) and macrophages (53), TBK1 is not required for RNA virus-induced IFN expression and activation. IFN expression in response to DNA viruses, B-DNA and TLR4 stimulation was abrogated in TBK1 deficient macrophages (53).

Putative Mechanism

The effect of the Pioneer mutation on TBK1 expression and activity has not been tested.  Because the mutation exists in the kinase domain and is predicted to be “probably damaging” by PolyPhen-2, it may be hypothesized that kinase function is impaired, resulting in failure to phosphorylate its substrates.  Inability to phosphorylate IRF3 and IRF7 would result in reduced type I IFN production in response to dsDNA stimulation of Pioneer macrophages.

Primers

Primers cannot be located by automatic search.

Genotyping

Pioneer genotyping is performed by PCR amplifying regions on Tbk1 that contain the mutation. The PCR product is subsequently sequenced to detect the nucleotide change.

The following primers were used for PCR amplification of Tbk1:

Primers for PCR amplification

TBK1_F: 5’- AGTGCTGAGAGGGTACACTCAGG -3’

TBK1_R: 5’- GCATTAGAGAAGTGCTGTGGATACAACA -3’

Primers for Sequencing

TBK1_Seq_R: 5’- GCTGTGGATACAACACTAGGTTAC -3’

The following sequence of 400 nucleotides (from Genbank genomic region: of the linear genomic sequence NC_000076.6 of Tbk1) is amplified: 

    

7921                           agtgct gagagggtac actcaggctg agggtgtgag

7981 ctgagagggt acactcaggc tgagggtgtg agtgctgaga gggtacaggt tgccatggtt

8041 taatcactga ctccttcttt ttgttgtctt ttagaaaact ggtgatctct atgctgtcaa

8101 agtatttaat aacataagct tccttcgccc agtggatgtt caaatgagag aatttgaagt

8161 gttaaaaaaa ctcaatcaca aaaacattgt caagttattt gctattgaag aggaggtgag

8221 tacacaggct ggccgctggg ttgtgtcccc tactcagaag acagggcctc actgagggtt

8281 acaaacgcca cacgatctgt ggctcttgta acctagtgtt gtatccacag cacttctcta

8341 atgc

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is shown in red text (T>A, sense strand; A>T, Chr. + strand).

References

  1. Bonnard, M., Mirtsos, C., Suzuki, S., Graham, K., Huang, J., Ng, M., Itie, A., Wakeham, A., Shahinian, A., Henzel, W. J., Elia, A. J., Shillinglaw, W., Mak, T. W., Cao, Z., and Yeh, W. C. (2000) Deficiency of T2K Leads to Apoptotic Liver Degeneration and Impaired NF-kappaB-Dependent Gene Transcription. EMBO J. 19, 4976-4985.

  2. Pomerantz, J. L., and Baltimore, D. (1999) NF-kappaB Activation by a Signaling Complex Containing TRAF2, TANK and TBK1, a Novel IKK-Related Kinase. EMBO J. 18, 6694-6704.

  3. Hiscott, J. (2007) Convergence of the NF-kappaB and IRF Pathways in the Regulation of the Innate Antiviral Response. Cytokine Growth Factor Rev. 18, 483-490.

  4. Shimada, T., Kawai, T., Takeda, K., Matsumoto, M., Inoue, J., Tatsumi, Y., Kanamaru, A., and Akira, S. (1999) IKK-i, a Novel Lipopolysaccharide-Inducible Kinase that is Related to IkappaB Kinases. Int Immunol. 11, 1357-1362.

  5. Peters, R. T., Liao, S. M., and Maniatis, T. (2000) IKKepsilon is Part of a Novel PMA-Inducible IkappaB Kinase Complex. Mol Cell. 5, 513-522.

  6. Peters, R. T., and Maniatis, T. (2001) A New Family of IKK-Related Kinases may Function as I Kappa B Kinase Kinases. Biochim Biophys Acta. 1471, M57-62.

  7. Hemmi, H., Takeuchi, O., Sato, S., Yamamoto, M., Kaisho, T., Sanjo, H., Kawai, T., Hoshino, K., Takeda, K., and Akira, S. (2004) The Roles of Two IkappaB Kinase-Related Kinases in Lipopolysaccharide and Double Stranded RNA Signaling and Viral Infection. J Exp Med. 199, 1641-1650.

  8. McWhirter, S. M., Fitzgerald, K. A., Rosains, J., Rowe, D. C., Golenbock, D. T., and Maniatis, T. (2004) IFN-Regulatory Factor 3-Dependent Gene Expression is Defective in Tbk1-Deficient Mouse Embryonic Fibroblasts. Proc Natl Acad Sci U S A. 101, 233-238.

  9. Sharma, S., tenOever, B. R., Grandvaux, N., Zhou, G. P., Lin, R., and Hiscott, J. (2003) Triggering the Interferon Antiviral Response through an IKK-Related Pathway. Science. 300, 1148-1151.

  10. Fitzgerald, K. A., McWhirter, S. M., Faia, K. L., Rowe, D. C., Latz, E., Golenbock, D. T., Coyle, A. J., Liao, S. M., and Maniatis, T. (2003) IKKepsilon and TBK1 are Essential Components of the IRF3 Signaling Pathway. Nat Immunol. 4, 491-496.

  11. Tojima, Y., Fujimoto, A., Delhase, M., Chen, Y., Hatakeyama, S., Nakayama, K., Kaneko, Y., Nimura, Y., Motoyama, N., Ikeda, K., Karin, M., and Nakanishi, M. (2000) NAK is an IkappaB Kinase-Activating Kinase. Nature. 404, 778-782.

  12. Kishore, N., Huynh, Q. K., Mathialagan, S., Hall, T., Rouw, S., Creely, D., Lange, G., Caroll, J., Reitz, B., Donnelly, A., Boddupalli, H., Combs, R. G., Kretzmer, K., and Tripp, C. S. (2002) IKK-i and TBK-1 are Enzymatically Distinct from the Homologous Enzyme IKK-2: Comparative Analysis of Recombinant Human IKK-i, TBK-1, and IKK-2. J Biol Chem. 277, 13840-13847.

  13. Hacker, H., and Karin, M. (2006) Regulation and Function of IKK and IKK-Related Kinases. Sci STKE. 2006, re13.

  14. Ikeda, F., Hecker, C. M., Rozenknop, A., Nordmeier, R. D., Rogov, V., Hofmann, K., Akira, S., Dotsch, V., and Dikic, I. (2007) Involvement of the Ubiquitin-Like Domain of TBK1/IKK-i Kinases in Regulation of IFN-Inducible Genes. EMBO J. 26, 3451-3462.

  15. Goncalves, A., Burckstummer, T., Dixit, E., Scheicher, R., Gorna, M. W., Karayel, E., Sugar, C., Stukalov, A., Berg, T., Kralovics, R., Planyavsky, M., Bennett, K. L., Colinge, J., and Superti-Furga, G. (2011) Functional Dissection of the TBK1 Molecular Network. PLoS One. 6, e23971.

  16. Deng, W., Shi, M., Han, M., Zhong, J., Li, Z., Li, W., Hu, Y., Yan, L., Wang, J., He, Y., Tang, H., Deubel, V., Luo, X., Ning, Q., and Sun, B. (2008) Negative Regulation of Virus-Triggered IFN-Beta Signaling Pathway by Alternative Splicing of TBK1. J Biol Chem. 283, 35590-35597.

  17. Ma, X., Helgason, E., Phung, Q. T., Quan, C. L., Iyer, R. S., Lee, M. W., Bowman, K. K., Starovasnik, M. A., and Dueber, E. C. (2012) Molecular Basis of Tank-Binding Kinase 1 Activation by Transautophosphorylation. Proc Natl Acad Sci U S A. 109, 9378-9383.

  18. Zandi, E., Rothwarf, D. M., Delhase, M., Hayakawa, M., and Karin, M. (1997) The IkappaB Kinase Complex (IKK) Contains Two Kinase Subunits, IKKalpha and IKKbeta, Necessary for IkappaB Phosphorylation and NF-kappaB Activation. Cell. 91, 243-252.

  19. Regnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z., and Rothe, M. (1997) Identification and Characterization of an IkappaB Kinase. Cell. 90, 373-383.

  20. McKenzie, F. R., Connelly, M. A., Balzarano, D., Muller, J. R., Geleziunas, R., and Marcu, K. B. (2000) Functional Isoforms of IkappaB Kinase Alpha (IKKalpha) Lacking Leucine Zipper and Helix-Loop-Helix Domains Reveal that IKKalpha and IKKbeta have Different Activation Requirements. Mol Cell Biol. 20, 2635-2649.

  21. Marie, I., Durbin, J. E., and Levy, D. E. (1998) Differential Viral Induction of Distinct Interferon-Alpha Genes by Positive Feedback through Interferon Regulatory Factor-7. EMBO J. 17, 6660-6669.

  22. Lin, R., Mamane, Y., and Hiscott, J. (2000) Multiple Regulatory Domains Control IRF-7 Activity in Response to Virus Infection. J Biol Chem. 275, 34320-34327.

  23. Gatot, J. S., Gioia, R., Chau, T. L., Patrascu, F., Warnier, M., Close, P., Chapelle, J. P., Muraille, E., Brown, K., Siebenlist, U., Piette, J., Dejardin, E., and Chariot, A. (2007) Lipopolysaccharide-Mediated Interferon Regulatory Factor Activation Involves TBK1-IKKepsilon-Dependent Lys(63)-Linked Polyubiquitination and Phosphorylation of TANK/I-TRAF. J Biol Chem. 282, 31131-31146.

  24. Cheng, T. F., Brzostek, S., Ando, O., Van Scoy, S., Kumar, K. P., and Reich, N. C. (2006) Differential Activation of IFN Regulatory Factor (IRF)-3 and IRF-5 Transcription Factors during Viral Infection. J Immunol. 176, 7462-7470.

  25. Lin, R., Yang, L., Arguello, M., Penafuerte, C., and Hiscott, J. (2005) A CRM1-Dependent Nuclear Export Pathway is Involved in the Regulation of IRF-5 Subcellular Localization. J Biol Chem. 280, 3088-3095.

  26. Schoenemeyer, A., Barnes, B. J., Mancl, M. E., Latz, E., Goutagny, N., Pitha, P. M., Fitzgerald, K. A., and Golenbock, D. T. (2005) The Interferon Regulatory Factor, IRF5, is a Central Mediator of Toll-Like Receptor 7 Signaling. J Biol Chem. 280, 17005-17012.

  27. Soulat, D., Burckstummer, T., Westermayer, S., Goncalves, A., Bauch, A., Stefanovic, A., Hantschel, O., Bennett, K. L., Decker, T., and Superti-Furga, G. (2008) The DEAD-Box Helicase DDX3X is a Critical Component of the TANK-Binding Kinase 1-Dependent Innate Immune Response. EMBO J. 27, 2135-2146.

  28. Schroder, M., Baran, M., and Bowie, A. G. (2008) Viral Targeting of DEAD Box Protein 3 Reveals its Role in TBK1/IKKepsilon-Mediated IRF Activation. EMBO J. 27, 2147-2157.

  29. Nomura, F., Kawai, T., Nakanishi, K., and Akira, S. (2000) NF-kappaB Activation through IKK-i-Dependent I-TRAF/TANK Phosphorylation. Genes Cells. 5, 191-202.

  30. Munoz, M. C., Giani, J. F., Mayer, M. A., Toblli, J. E., Turyn, D., and Dominici, F. P. (2009) TANK-Binding Kinase 1 Mediates Phosphorylation of Insulin Receptor at Serine Residue 994: A Potential Link between Inflammation and Insulin Resistance. J Endocrinol. 201, 185-197.

  31. Joung, S. M., Park, Z. Y., Rani, S., Takeuchi, O., Akira, S., and Lee, J. Y. (2011) Akt Contributes to Activation of the TRIF-Dependent Signaling Pathways of TLRs by Interacting with TANK-Binding Kinase 1. J Immunol. 186, 499-507.

  32. Xie, X., Zhang, D., Zhao, B., Lu, M. K., You, M., Condorelli, G., Wang, C. Y., and Guan, K. L. (2011) IkappaB Kinase Epsilon and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation. Proc Natl Acad Sci U S A. 108, 6474-6479.

  33. Buss, H., Dorrie, A., Schmitz, M. L., Hoffmann, E., Resch, K., and Kracht, M. (2004) Constitutive and Interleukin-1-Inducible Phosphorylation of p65 NF-{Kappa}B at Serine 536 is Mediated by Multiple Protein Kinases Including I{Kappa}B Kinase (IKK)-{Alpha}, IKK{Beta}, IKK{Epsilon}, TRAF Family Member-Associated (TANK)-Binding Kinase 1 (TBK1), and an Unknown Kinase and Couples p65 to TATA-Binding Protein-Associated Factor II31-Mediated Interleukin-8 Transcription. J Biol Chem. 279, 55633-55643.

  34. Mattioli, I., Geng, H., Sebald, A., Hodel, M., Bucher, C., Kracht, M., and Schmitz, M. L. (2006) Inducible Phosphorylation of NF-Kappa B p65 at Serine 468 by T Cell Costimulation is Mediated by IKK Epsilon. J Biol Chem. 281, 6175-6183.

  35. Harris, J., Oliere, S., Sharma, S., Sun, Q., Lin, R., Hiscott, J., and Grandvaux, N. (2006) Nuclear Accumulation of cRel Following C-Terminal Phosphorylation by TBK1/IKK Epsilon. J Immunol. 177, 2527-2535.

  36. Rothe, M., Pan, M. G., Henzel, W. J., Ayres, T. M., and Goeddel, D. V. (1995) The TNFR2-TRAF Signaling Complex Contains Two Novel Proteins Related to Baculoviral-Inhibitor of Apoptosis Proteins. Cell. 83, 1243-1252.

  37. Mao, A. P., Li, S., Zhong, B., Li, Y., Yan, J., Li, Q., Teng, C., and Shu, H. B. (2010) Virus-Triggered Ubiquitination of TRAF3/6 by cIAP1/2 is Essential for Induction of Interferon-Beta (IFN-Beta) and Cellular Antiviral Response. J Biol Chem. 285, 9470-9476.

  38. Shembade, N., Harhaj, N. S., Parvatiyar, K., Copeland, N. G., Jenkins, N. A., Matesic, L. E., and Harhaj, E. W. (2008) The E3 Ligase Itch Negatively Regulates Inflammatory Signaling Pathways by Controlling the Function of the Ubiquitin-Editing Enzyme A20. Nat Immunol. 9, 254-262.

  39. Parvatiyar, K., Barber, G. N., and Harhaj, E. W. (2010) TAX1BP1 and A20 Inhibit Antiviral Signaling by Targeting TBK1-IKKi Kinases. J Biol Chem. 285, 14999-15009.

  40. Zhong, B., Yang, Y., Li, S., Wang, Y. Y., Li, Y., Diao, F., Lei, C., He, X., Zhang, L., Tien, P., and Shu, H. B. (2008) The Adaptor Protein MITA Links Virus-Sensing Receptors to IRF3 Transcription Factor Activation. Immunity. 29, 538-550.

  41. Wang, Z., Choi, M. K., Ban, T., Yanai, H., Negishi, H., Lu, Y., Tamura, T., Takaoka, A., Nishikura, K., and Taniguchi, T. (2008) Regulation of Innate Immune Responses by DAI (DLM-1/ZBP1) and Other DNA-Sensing Molecules. Proc Natl Acad Sci U S A. 105, 5477-5482.

  42. Chau, T. L., Gioia, R., Gatot, J. S., Patrascu, F., Carpentier, I., Chapelle, J. P., O'Neill, L., Beyaert, R., Piette, J., and Chariot, A. (2008) Are the IKKs and IKK-Related Kinases TBK1 and IKK-Epsilon Similarly Activated? Trends Biochem Sci. 33, 171-180.

  43. Clark, K., Peggie, M., Plater, L., Sorcek, R. J., Young, E. R., Madwed, J. B., Hough, J., McIver, E. G., and Cohen, P. (2011) Novel Cross-Talk within the IKK Family Controls Innate Immunity. Biochem J. 434, 93-104.

  44. Li, J., Li, J., Miyahira, A., Sun, J., Liu, Y., Cheng, G., and Liang, H. (2012) Crystal Structure of the Ubiquitin-Like Domain of Human TBK1. Protein Cell. 3, 383-391.

  45. Zandi, E., Chen, Y., and Karin, M. (1998) Direct Phosphorylation of IkappaB by IKKalpha and IKKbeta: Discrimination between Free and NF-kappaB-Bound Substrate. Science. 281, 1360-1363.

  46. Wang, L., Li, S., and Dorf, M. E. (2012) NEMO Binds Ubiquitinated TANK-Binding Kinase 1 (TBK1) to Regulate Innate Immune Responses to RNA Viruses. PLoS One. 7, e43756.

  47. Bhoj, V. G., and Chen, Z. J. (2009) Ubiquitylation in Innate and Adaptive Immunity. Nature. 458, 430-437.

  48. Li, S., Wang, L., Berman, M., Kong, Y. Y., and Dorf, M. E. (2011) Mapping a Dynamic Innate Immunity Protein Interaction Network Regulating Type I Interferon Production. Immunity. 35, 426-440.

  49. Wang, C., Chen, T., Zhang, J., Yang, M., Li, N., Xu, X., and Cao, X. (2009) The E3 Ubiquitin Ligase Nrdp1 'Preferentially' Promotes TLR-Mediated Production of Type I Interferon. Nat Immunol. 10, 744-752.

  50. Aupperle, K. R., Yamanishi, Y., Bennett, B. L., Mercurio, F., Boyle, D. L., and Firestein, G. S. (2001) Expression and Regulation of Inducible IkappaB Kinase (IKK-i) in Human Fibroblast-Like Synoviocytes. Cell Immunol. 214, 54-59.

  51. Gabhann, J. N., Higgs, R., Brennan, K., Thomas, W., Damen, J. E., Ben Larbi, N., Krystal, G., and Jefferies, C. A. (2010) Absence of SHIP-1 Results in Constitutive Phosphorylation of Tank-Binding Kinase 1 and Enhanced TLR3-Dependent IFN-Beta Production. J Immunol. 184, 2314-2320.

  52. Saitoh, T., Fujita, N., Hayashi, T., Takahara, K., Satoh, T., Lee, H., Matsunaga, K., Kageyama, S., Omori, H., Noda, T., Yamamoto, N., Kawai, T., Ishii, K., Takeuchi, O., Yoshimori, T., and Akira, S. (2009) Atg9a Controls dsDNA-Driven Dynamic Translocation of STING and the Innate Immune Response. Proc Natl Acad Sci U S A. 106, 20842-20846.

  53. Miyahira, A. K., Shahangian, A., Hwang, S., Sun, R., and Cheng, G. (2009) TANK-Binding Kinase-1 Plays an Important Role during in Vitro and in Vivo Type I IFN Responses to DNA Virus Infections. J Immunol. 182, 2248-2257.

  54. tenOever, B. R., Sharma, S., Zou, W., Sun, Q., Grandvaux, N., Julkunen, I., Hemmi, H., Yamamoto, M., Akira, S., Yeh, W. C., Lin, R., and Hiscott, J. (2004) Activation of TBK1 and IKKvarepsilon Kinases by Vesicular Stomatitis Virus Infection and the Role of Viral Ribonucleoprotein in the Development of Interferon Antiviral Immunity. J Virol. 78, 10636-10649.

  55. Bibeau-Poirier, A., Gravel, S. P., Clement, J. F., Rolland, S., Rodier, G., Coulombe, P., Hiscott, J., Grandvaux, N., Meloche, S., and Servant, M. J. (2006) Involvement of the IkappaB Kinase (IKK)-Related Kinases Tank-Binding Kinase 1/IKKi and Cullin-Based Ubiquitin Ligases in IFN Regulatory Factor-3 Degradation. J Immunol. 177, 5059-5067.

  56. Takeda, K., and Akira, S. (2004) TLR Signaling Pathways. Semin Immunol. 16, 3-9.

  57. Kawai, T., Sato, S., Ishii, K. J., Coban, C., Hemmi, H., Yamamoto, M., Terai, K., Matsuda, M., Inoue, J., Uematsu, S., Takeuchi, O., and Akira, S. (2004) Interferon-Alpha Induction through Toll-Like Receptors Involves a Direct Interaction of IRF7 with MyD88 and TRAF6. Nat Immunol. 5, 1061-1068.

  58. Herman, M., Ciancanelli, M., Ou, Y. H., Lorenzo, L., Klaudel-Dreszler, M., Pauwels, E., Sancho-Shimizu, V., Perez de Diego, R., Abhyankar, A., Israelsson, E., Guo, Y., Cardon, A., Rozenberg, F., Lebon, P., Tardieu, M., Heropolitanska-Pliszka, E., Chaussabel, D., White, M. A., Abel, L., Zhang, S. Y., and Casanova, J. L. (2012) Heterozygous TBK1 Mutations Impair TLR3 Immunity and Underlie Herpes Simplex Encephalitis of Childhood. J Exp Med. 209, 1567-1582.

  59. Cui, J., Li, Y., Zhu, L., Liu, D., Songyang, Z., Wang, H. Y., and Wang, R. F. (2012) NLRP4 Negatively Regulates Type I Interferon Signaling by Targeting the Kinase TBK1 for Degradation Via the Ubiquitin Ligase DTX4. Nat Immunol. 13, 387-395.

  60. Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., and Tschopp, J. (2005) Cardif is an Adaptor Protein in the RIG-I Antiviral Pathway and is Targeted by Hepatitis C Virus. Nature. 437, 1167-1172.

  61. Seth, R. B., Sun, L., Ea, C. K., and Chen, Z. J. (2005) Identification and Characterization of MAVS, a Mitochondrial Antiviral Signaling Protein that Activates NF-kappaB and IRF 3. Cell. 122, 669-682.

  62. Xu, L. G., Wang, Y. Y., Han, K. J., Li, L. Y., Zhai, Z., and Shu, H. B. (2005) VISA is an Adapter Protein Required for Virus-Triggered IFN-Beta Signaling. Mol Cell. 19, 727-740.

  63. Wang, Y. Y., Liu, L. J., Zhong, B., Liu, T. T., Li, Y., Yang, Y., Ran, Y., Li, S., Tien, P., and Shu, H. B. (2010) WDR5 is Essential for Assembly of the VISA-Associated Signaling Complex and Virus-Triggered IRF3 and NF-kappaB Activation. Proc Natl Acad Sci U S A. 107, 815-820.

  64. Hiscott, J., Grandvaux, N., Sharma, S., Tenoever, B. R., Servant, M. J., and Lin, R. (2003) Convergence of the NF-kappaB and Interferon Signaling Pathways in the Regulation of Antiviral Defense and Apoptosis. Ann N Y Acad Sci. 1010, 237-248.

  65. Kawai, T., and Akira, S. (2008) Toll-Like Receptor and RIG-I-Like Receptor Signaling. Ann N Y Acad Sci. 1143, 1-20.

  66. Ishii, K. J., Coban, C., Kato, H., Takahashi, K., Torii, Y., Takeshita, F., Ludwig, H., Sutter, G., Suzuki, K., Hemmi, H., Sato, S., Yamamoto, M., Uematsu, S., Kawai, T., Takeuchi, O., and Akira, S. (2006) A Toll-Like Receptor-Independent Antiviral Response Induced by Double-Stranded B-Form DNA. Nat Immunol. 7, 40-48.

  67. Takaoka, A., Wang, Z., Choi, M. K., Yanai, H., Negishi, H., Ban, T., Lu, Y., Miyagishi, M., Kodama, T., Honda, K., Ohba, Y., and Taniguchi, T. (2007) DAI (DLM-1/ZBP1) is a Cytosolic DNA Sensor and an Activator of Innate Immune Response. Nature. 448, 501-505.

  68. Takeshita, F., and Ishii, K. J. (2008) Intracellular DNA Sensors in Immunity. Curr Opin Immunol. 20, 383-388.

  69. Ishii, K. J., Kawagoe, T., Koyama, S., Matsui, K., Kumar, H., Kawai, T., Uematsu, S., Takeuchi, O., Takeshita, F., Coban, C., and Akira, S. (2008) TANK-Binding Kinase-1 Delineates Innate and Adaptive Immune Responses to DNA Vaccines. Nature. 451, 725-729.

  70. Lippmann, J., Rothenburg, S., Deigendesch, N., Eitel, J., Meixenberger, K., van Laak, V., Slevogt, H., N'guessan, P. D., Hippenstiel, S., Chakraborty, T., Flieger, A., Suttorp, N., and Opitz, B. (2008) IFNbeta Responses Induced by Intracellular Bacteria Or Cytosolic DNA in Different Human Cells do Not Require ZBP1 (DLM-1/DAI). Cell Microbiol. 10, 2579-2588.

  71. Zhang, Z., Yuan, B., Bao, M., Lu, N., Kim, T., and Liu, Y. J. (2011) The Helicase DDX41 Senses Intracellular DNA Mediated by the Adaptor STING in Dendritic Cells. Nat Immunol. 12, 959-965.

  72. Unterholzner, L., Keating, S. E., Baran, M., Horan, K. A., Jensen, S. B., Sharma, S., Sirois, C. M., Jin, T., Latz, E., Xiao, T. S., Fitzgerald, K. A., Paludan, S. R., and Bowie, A. G. (2010) IFI16 is an Innate Immune Sensor for Intracellular DNA. Nat Immunol. 11, 997-1004.

  73. Ishikawa, H., and Barber, G. N. (2008) STING is an Endoplasmic Reticulum Adaptor that Facilitates Innate Immune Signalling. Nature. 455, 674-678.

  74. Cheng, G., Zhong, J., Chung, J., and Chisari, F. V. (2007) Double-Stranded DNA and Double-Stranded RNA Induce a Common Antiviral Signaling Pathway in Human Cells. Proc Natl Acad Sci U S A. 104, 9035-9040.

  75. Ishikawa, H., Ma, Z., and Barber, G. N. (2009) STING Regulates Intracellular DNA-Mediated, Type I Interferon-Dependent Innate Immunity. Nature. 461, 788-792.

  76. Burdette, D. L., Monroe, K. M., Sotelo-Troha, K., Iwig, J. S., Eckert, B., Hyodo, M., Hayakawa, Y., and Vance, R. E. (2011) STING is a Direct Innate Immune Sensor of Cyclic Di-GMP. Nature. 478, 515-518.

  77. Shu, C., Yi, G., Watts, T., Kao, C. C., and Li, P. (2012) Structure of STING Bound to Cyclic Di-GMP Reveals the Mechanism of Cyclic Dinucleotide Recognition by the Immune System. Nat Struct Mol Biol. 19, 722-724.

  78. Ouyang, S., Song, X., Wang, Y., Ru, H., Shaw, N., Jiang, Y., Niu, F., Zhu, Y., Qiu, W., Parvatiyar, K., Li, Y., Zhang, R., Cheng, G., and Liu, Z. J. (2012) Structural Analysis of the STING Adaptor Protein Reveals a Hydrophobic Dimer Interface and Mode of Cyclic Di-GMP Binding. Immunity. 36, 1073-1086.

  79. Yin, Q., Tian, Y., Kabaleeswaran, V., Jiang, X., Tu, D., Eck, M. J., Chen, Z. J., and Wu, H. (2012) Cyclic Di-GMP Sensing Via the Innate Immune Signaling Protein STING. Mol Cell. 46, 735-745.

  80. Tamayo, R., Pratt, J. T., and Camilli, A. (2007) Roles of Cyclic Diguanylate in the Regulation of Bacterial Pathogenesis. Annu Rev Microbiol. 61, 131-148.

  81. Karaolis, D. K., Means, T. K., Yang, D., Takahashi, M., Yoshimura, T., Muraille, E., Philpott, D., Schroeder, J. T., Hyodo, M., Hayakawa, Y., Talbot, B. G., Brouillette, E., and Malouin, F. (2007) Bacterial c-Di-GMP is an Immunostimulatory Molecule. J Immunol. 178, 2171-2181.

  82. Chen, W., Kuolee, R., and Yan, H. (2010) The Potential of 3',5'-Cyclic Diguanylic Acid (c-Di-GMP) as an Effective Vaccine Adjuvant. Vaccine. 28, 3080-3085.

  83. Sondermann, H., Shikuma, N. J., and Yildiz, F. H. (2012) You'Ve Come a Long Way: C-Di-GMP Signaling. Curr Opin Microbiol. 15, 140-146.

  84. Pesavento, C., and Hengge, R. (2009) Bacterial Nucleotide-Based Second Messengers. Curr Opin Microbiol. 12, 170-176.

  85. McWhirter, S. M., Barbalat, R., Monroe, K. M., Fontana, M. F., Hyodo, M., Joncker, N. T., Ishii, K. J., Akira, S., Colonna, M., Chen, Z. J., Fitzgerald, K. A., Hayakawa, Y., and Vance, R. E. (2009) A Host Type I Interferon Response is Induced by Cytosolic Sensing of the Bacterial Second Messenger Cyclic-Di-GMP. J Exp Med. 206, 1899-1911.

  86. Woodward, J. J., Iavarone, A. T., and Portnoy, D. A. (2010) C-Di-AMP Secreted by Intracellular Listeria Monocytogenes Activates a Host Type I Interferon Response. Science. 328, 1703-1705.

  87. Fujita, F., Taniguchi, Y., Kato, T., Narita, Y., Furuya, A., Ogawa, T., Sakurai, H., Joh, T., Itoh, M., Delhase, M., Karin, M., and Nakanishi, M. (2003) Identification of NAP1, a Regulatory Subunit of IkappaB Kinase-Related Kinases that Potentiates NF-kappaB Signaling. Mol Cell Biol. 23, 7780-7793.

  88. Sato, S., Sugiyama, M., Yamamoto, M., Watanabe, Y., Kawai, T., Takeda, K., and Akira, S. (2003) Toll/IL-1 Receptor Domain-Containing Adaptor Inducing IFN-Beta (TRIF) Associates with TNF Receptor-Associated Factor 6 and TANK-Binding Kinase 1, and Activates Two Distinct Transcription Factors, NF-Kappa B and IFN-Regulatory Factor-3, in the Toll-Like Receptor Signaling. J Immunol. 171, 4304-4310.

  89. Guo, B., and Cheng, G. (2007) Modulation of the Interferon Antiviral Response by the TBK1/IKKi Adaptor Protein TANK. J Biol Chem. 282, 11817-11826.

  90. Rothe, M., Xiong, J., Shu, H. B., Williamson, K., Goddard, A., and Goeddel, D. V. (1996) I-TRAF is a Novel TRAF-Interacting Protein that Regulates TRAF-Mediated Signal Transduction. Proc Natl Acad Sci USA. 93, 8241-8246.

  91. Sasai, M., Shingai, M., Funami, K., Yoneyama, M., Fujita, T., Matsumoto, M., and Seya, T. (2006) NAK-Associated Protein 1 Participates in both the TLR3 and the Cytoplasmic Pathways in Type I IFN Induction. J Immunol. 177, 8676-8683.

  92. Sasai, M., Oshiumi, H., Matsumoto, M., Inoue, N., Fujita, F., Nakanishi, M., and Seya, T. (2005) Cutting Edge: NF-kappaB-Activating Kinase-Associated Protein 1 Participates in TLR3/Toll-IL-1 Homology Domain-Containing Adapter Molecule-1-Mediated IFN Regulatory Factor 3 Activation. J Immunol. 174, 27-30.

  93. Ryzhakov, G., and Randow, F. (2007) SINTBAD, a Novel Component of Innate Antiviral Immunity, Shares a TBK1-Binding Domain with NAP1 and TANK. EMBO J. 26, 3180-3190.

  94. Yang, K., Shi, H., Qi, R., Sun, S., Tang, Y., Zhang, B., and Wang, C. (2006) Hsp90 Regulates Activation of Interferon Regulatory Factor 3 and TBK-1 Stabilization in Sendai Virus-Infected Cells. Mol Biol Cell. 17, 1461-1471.

  95. Ermolaeva, M. A., Michallet, M. C., Papadopoulou, N., Utermohlen, O., Kranidioti, K., Kollias, G., Tschopp, J., and Pasparakis, M. (2008) Function of TRADD in Tumor Necrosis Factor Receptor 1 Signaling and in TRIF-Dependent Inflammatory Responses. Nat Immunol. 9, 1037-1046.

  96. Michallet, M. C., Meylan, E., Ermolaeva, M. A., Vazquez, J., Rebsamen, M., Curran, J., Poeck, H., Bscheider, M., Hartmann, G., Konig, M., Kalinke, U., Pasparakis, M., and Tschopp, J. (2008) TRADD Protein is an Essential Component of the RIG-Like Helicase Antiviral Pathway. Immunity. 28, 651-661.

  97. Balachandran, S., Thomas, E., and Barber, G. N. (2004) A FADD-Dependent Innate Immune Mechanism in Mammalian Cells. Nature. 432, 401-405.

  98. Oganesyan, G., Saha, S. K., Guo, B., He, J. Q., Shahangian, A., Zarnegar, B., Perry, A., and Cheng, G. (2006) Critical Role of TRAF3 in the Toll-Like Receptor-Dependent and -Independent Antiviral Response. Nature. 439, 208-211.

  99. Chariot, A., Leonardi, A., Muller, J., Bonif, M., Brown, K., and Siebenlist, U. (2002) Association of the Adaptor TANK with the I Kappa B Kinase (IKK) Regulator NEMO Connects IKK Complexes with IKK Epsilon and TBK1 Kinases. J Biol Chem. 277, 37029-37036.

  100. Tanaka, Y., and Chen, Z. J. (2012) STING Specifies IRF3 Phosphorylation by TBK1 in the Cytosolic DNA Signaling Pathway. Sci Signal. 5, ra20.

  101. Cheng, G., and Baltimore, D. (1996) TANK, a Co-Inducer with TRAF2 of TNF- and CD 40L-Mediated NF-kappaB Activation. Genes Dev. 10, 963-973.

  102. Renner, F., Saul, V. V., Pagenstecher, A., Wittwer, T., and Schmitz, M. L. (2011) Inducible SUMO Modification of TANK Alleviates its Repression of TLR7 Signalling. EMBO Rep. 12, 129-135.

  103. Chien, Y., Kim, S., Bumeister, R., Loo, Y. M., Kwon, S. W., Johnson, C. L., Balakireva, M. G., Romeo, Y., Kopelovich, L., Gale, M.,Jr, Yeaman, C., Camonis, J. H., Zhao, Y., and White, M. A. (2006) RalB GTPase-Mediated Activation of the IkappaB Family Kinase TBK1 Couples Innate Immune Signaling to Tumor Cell Survival. Cell. 127, 157-170.

  104. Clement, J. F., Meloche, S., and Servant, M. J. (2008) The IKK-Related Kinases: From Innate Immunity to Oncogenesis. Cell Res. 18, 889-899.

  105. Delhase, M., Kim, S. Y., Lee, H., Naiki-Ito, A., Chen, Y., Ahn, E. R., Murata, K., Kim, S. J., Lautsch, N., Kobayashi, K. S., Shirai, T., Karin, M., and Nakanishi, M. (2012) TANK-Binding Kinase 1 (TBK1) Controls Cell Survival through PAI-2/serpinB2 and Transglutaminase 2. Proc Natl Acad Sci U S A. 109, E177-86.

  106. Hasan, U. A., Caux, C., Perrot, I., Doffin, A. C., Menetrier-Caux, C., Trinchieri, G., Tommasino, M., and Vlach, J. (2007) Cell Proliferation and Survival Induced by Toll-Like Receptors is Antagonized by Type I IFNs. Proc Natl Acad Sci U S A. 104, 8047-8052.

  107. Liang, J., Zubovitz, J., Petrocelli, T., Kotchetkov, R., Connor, M. K., Han, K., Lee, J. H., Ciarallo, S., Catzavelos, C., Beniston, R., Franssen, E., and Slingerland, J. M. (2002) PKB/Akt Phosphorylates p27, Impairs Nuclear Import of p27 and Opposes p27-Mediated G1 Arrest. Nat Med. 8, 1153-1160.

  108. Jin, J., Xiao, Y., Chang, J. H., Yu, J., Hu, H., Starr, R., Brittain, G. C., Chang, M., Cheng, X., and Sun, S. C. (2012) The Kinase TBK1 Controls IgA Class Switching by Negatively Regulating Noncanonical NF-kappaB Signaling. Nat Immunol. .

  109. Korherr, C., Gille, H., Schafer, R., Koenig-Hoffmann, K., Dixelius, J., Egland, K. A., Pastan, I., and Brinkmann, U. (2006) Identification of Proangiogenic Genes and Pathways by High-Throughput Functional Genomics: TBK1 and the IRF3 Pathway. Proc Natl Acad Sci U S A. 103, 4240-4245.

  110. Matsui, K., Kumagai, Y., Kato, H., Sato, S., Kawagoe, T., Uematsu, S., Takeuchi, O., and Akira, S. (2006) Cutting Edge: Role of TANK-Binding Kinase 1 and Inducible IkappaB Kinase in IFN Responses Against Viruses in Innate Immune Cells. J Immunol. 177, 5785-5789.

  111. Marchlik, E., Thakker, P., Carlson, T., Jiang, Z., Ryan, M., Marusic, S., Goutagny, N., Kuang, W., Askew, G. R., Roberts, V., Benoit, S., Zhou, T., Ling, V., Pfeifer, R., Stedman, N., Fitzgerald, K. A., Lin, L. L., and Hall, J. P. (2010) Mice Lacking Tbk1 Activity Exhibit Immune Cell Infiltrates in Multiple Tissues and Increased Susceptibility to LPS-Induced Lethality. J Leukoc Biol. 88, 1171-1180.

  112. Yu, G. Y., He, G., Li, C. Y., Tang, M., Grivennikov, S., Tsai, W. T., Wu, M. S., Hsu, C. W., Tsai, Y., Wang, L. H., and Karin, M. (2012) Hepatic Expression of HCV RNA-Dependent RNA Polymerase Triggers Innate Immune Signaling and Cytokine Production. Mol Cell. .