Phenotypic Mutation 'voldemort'

• Allele: voldemort
• Chromosome: 15
• Gene: Slc45a2
• Gene Name: solute carrier family 45, member 2
• Synonym(s): Aim1, Dbr, blanc-sale, dominant brown, Aim-1, Matp, bls, Oca4
• Chromosomal Location: 11,000,807-11,029,319 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] ; PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Ref Sequences:
  Ensembl: ENSMUSP00000022851
• Gene Model: not available
• AlphaFold: P58355
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.073)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: 2012-12-18 8:32 AM by Tiana Purrington
• Record Posted: 2014-09-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Tiana Purrington

Accession Number

NCBI RefSeq: NM_053077; MGI:2153040

Alleles Listed at MGI

All alleles(20) : Chemically induced (ENU)(10) Spontaneous(7) Targeted(3)

Phenotypic Description

Figure 1. Phenotype of an adult voldemort mouse.

The voldemort mutation was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R0122, some of which exhibited a white coat color and black eyes (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. Three G3 mice with the voldemort phenotype were genotyped at all 50 mutation sites and one mutation on chromosome 15, in Adamts12, was homozygous in all three mice. Subsequent analysis of three additional mice and 12 unaffected mice (all wild-type or heterozygous for the Adamts12 mutation) supported a causal relationship between the mutation in Adamts12 and the voldemort phenotype (LOD = 8.504). To confirm the causal relationship a TALEN knockout of Adamts12 (TALEN-Adamts12) was generated. All of the offspring from 12 TALEN-Adamts12 founders failed to recapitulate the voldemort phenotype, indicating that the mutation causing the voldemort phenotype was not identified. The Adamts12 mutation is closely linked to Slc45a2 and the voldemort phenotype is similar to that caused by Slc45a2 mutations [see the records for cardigan and zuckerkuss as well as Slc45a2^uw-6J (MGI:5448550) and Slc45a2^uw-7J (MGI:5448551)]. To confirm causality of the voldemort mutation by a complementation test for allelism, voldemort mice were mated to zuckerkuss mice that harbor a mutation in Slc45a2. The resulting offspring of the voldemort x zuckerkuss mating were white, indicating that the voldemort mutation is in Slc45a2.

Protein Prediction

Figure 2. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. This image is interactive. Click on the image to view other mutations found in SLC45A2. Click on the mutations for more specific information.  

Slc45a2 encodes solute carrier family 45, member 2 (SLC45A2), a highly conserved protein with 12 membrane-spanning domains that functions as a melanocyte differentiation antigen and transporter protein that is necessary for normal pigmentation (Figure 2) (1;2). The location of the voldemort mutation in SLC45A2 is unknown.

Please see the record cardigan for information about Slc45a2.

Putative Mechanism

Homozygous mice with Slc45a2 mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and fur (3). In addition, mutations in SLC45A2 can cause oculocutaneous albinism, type IV (OCA4; OMIM: #606574). The voldemort mice exhibit similar hypopigmentation to the proposed null mutant cardigan, indicating that the SLC45A2^voldemort is not functional.

Primers

Primers cannot be located by automatic search.

Genotyping

Voldemort genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

PCR Primers

Voldemort_PCR_F: 5’-TGTTTCACCCAGACACATGAGAACATC-3’

Voldemort_PCR_R: 5’-GGGATCATGTTGCCTGGCAAGAATAC-3’

Component	Amount (μl)
template (tail DNA)	2
primer (1) (10 μM)	2
primer (2) (10 μM)	2
JumpStart ReadyMix	25
dd Water	19
total	50

PCR program
1) 95°C 3:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 2:00
5) repeat steps (2-4) 40X
6) 72°C 7:00
7) 4°C ∞

Primers for sequencing

Voldemort_F1: 5’- GACACATGAGAACATCTCACTTG -3’

Voldemort_R1: 5’- CCTGGCAAGAATACTTTTTGATGAGG -3’

The following sequence of 454 nucleotides is amplified (Chr. 15: 11215384-11215837, GRCm38; NC_000081):

tgtttcaccc agacacatga gaacatctca cttgttatta agtataaatt aaacacatag
ctttggattt ttacaaatat aagttaaggg ttttatatac caaataatta ggtttataca
attggctttc tcactgtgtc ttctgtttaa tgttcagaca gtcttgataa ctctgtgaaa
caagagctac agcgggagaa gtgggagagg aaaaccttgc ggagcagaag cctctcccga
cgttccataa gcaaggagag atgggtggag accctcgtgg tggccgacac gaagacggta
gagtaccatg gaagcgagaa cgtggagtcg tacatcctca ccatcatgaa tatggtatga
cagactgcat gaggggacag cagtgaccga agggataccc ttaaaatgtt cttcctcctc
atcaaaaagt attcttgcca ggcaacatga tccc

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is indicated in red.

References

  1. Newton, J. M., Cohen-Barak, O., Hagiwara, N., Gardner, J. M., Davisson, M. T., King, R. A., and Brilliant, M. H. (2001) Mutations in the Human Orthologue of the Mouse Underwhite Gene (Uw) Underlie a New Form of Oculocutaneous Albinism, OCA4. Am J Hum Genet. 69, 981-988.

  2. Fukamachi, S., Shimada, A., and Shima, A. (2001) Mutations in the Gene Encoding B, a Novel Transporter Protein, Reduce Melanin Content in Medaka. Nat Genet. 28, 381-385.

  3. Sweet, H. O., Brilliant, M. H., Cook, S. A., Johnson, K. R., and Davisson, M. T. (1998) A New Allelic Series for the Underwhite Gene on Mouse Chromosome 15. J Hered. 89, 546-551.