Phenotypic Mutation 'Blue'

• Allele: Blue
• Mutation Type: missense
• Chromosome: 3
• Coordinate: 20,030,796 bp (GRCm38)
• Base Change: A ⇒ C (forward strand)
• Gene: Hps3
• Gene Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
• Synonym(s): coa, cocoa
• Chromosomal Location: 19,995,945-20,035,315 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015] ; PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Leucine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000012580] [ENSMUSP00000103957]
• AlphaFold: Q91VB4
• SMART Domains: Protein: ENSMUSP00000012580; Gene: ENSMUSG00000027615; AA Change: L76R

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	212	2.8e-74	PFAM
Pfam:HPS3_Mid	255	640	1.3e-167	PFAM
Pfam:HPS3_C	649	1000	1.8e-175	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000012580)
• SMART Domains: Protein: ENSMUSP00000103957; Gene: ENSMUSG00000027615

Domain	Start	End	E-Value	Type
Pfam:HPS3_N	3	87	5.6e-25	PFAM
Pfam:HPS3_Mid	121	508	4.2e-161	PFAM
Pfam:HPS3_C	517	870	9.2e-199	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Probably nonessential (E-score: 0.091)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• MMRRC Submission: 038237-MU
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2012-12-27 12:31 PM by Adam Dismang
• Record Posted: 2014-03-28
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek

Accession Number

NCBI RefSeq: NM_080634, NM_001146323, NM_001146324; MGI: 2153839

Alleles Listed at MGI

All alleles(12) : Targeted(4) Gene trapped(1) Spontaneous(6) Chemically induced(1)

Phenotypic Description

Figure 1. The blue mice have gray fur (top). An unaffected C57BL/6J mouse is shown for reference (bottom).

Blue was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant (Figure 1). The blue homozygous mice have a gray coat. 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. Three G3 mice with the blue phenotype were genotyped at all 72 mutation sites and three mutations on chromosome 3 (in Hps3, Gm5538, and Zfhx4) were homozygous in two of the three blue mice and heterozygous in one of the three blue mice. Blue phenocopies the pam gray phenotype attributed to Hps3. Therefore, the blue phenotype was ascribed to the Hps3 mutation. The mutation in Hps3 is a T to G transversion at base pair 20030796 (v38) on chromosome 3, or base pair 4515 in the GenBank genomic region NC_000069. The mutation corresponds to residue 272 in the mRNA sequence NM_080634 within exon 2 of 17 total exons.

 

256 GAAGCCGGAGACTATCTGGTAGCAATTGAGGAG 71  -E--A--G--D--Y--L--V--A--I--E--E-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to arginine (R) substitution at residue 76 in the HPS3 protein.

Protein Prediction

Figure 2. A, Predicted domains of HPS3. HPS3 contains a putative clathrin-binding (CB) motif, two consensus dileucine-based sorting motifs and an endoplasmic reticulum (ER) membrane retention signal. Amino acid locations are based on the human protein. The location of the blue mutation is indicated in red. Image is interactive: click to see other mutations in Hps3 (red indicates phenotypic mutations; green are incidental mutations). B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?).

The blue mutation (L76R) is not within or near known functional domains of HPS3 (Figure 2).

 

Please see the record pam gray for information about Hps3.

Putative Mechanism

Mutations in Hps3 have been documented to result in pigmentation defects [(1); MGI:2153839; pam gray; gandalf]. Mutations in Hps3 may alter protein trafficking during the maturation of melanosomes, resulting in hypopigmentation (2;3).  Proteins affected may include LAMP1 and LAMP3, and components of the melanin biosynthesis pathway, tyrosinase (mutated in ghost, pale rider, siamese), Tyrp1 (mutated in chi), and Tyrp2.

Primers

PCR Primer
Blue_pcr_F: AGTCAAATGCATCACGTACCTTCCG
Blue_pcr_R: CACACCTCAGAGGCTGTTGCTTAG

Genotyping

DNA trace file of the blue mutation. Chr. + strand.

Blue genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Blue(F): 5’- AGTCAAATGCATCACGTACCTTCCG -3’

Blue(R): 5’- CACACCTCAGAGGCTGTTGCTTAG-3’

 

Sequencing Primer

Blue_seq(F): 5’- CCATGTATAGGGTCTGACTCCAG -3’


 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 664 nucleotides is amplified (Chr.3: 20030295-20030958, GRCm38; NC_000069):

 

agtcaaatgc atcacgtacc ttccgcctct ttcaatggat tgctggtttc ttgtgggtgg

tggtcaacac tctctccatg tatagggtct gactccagtt ttaggagtaa gacttctaaa

tcagacatga cagcaacata tccaacacaa aaagagattt caacaggagt gatattatct

atgtgtataa ttaatgaacg ttcaaagttc aatattgaga attcctcatt aatgatatca

tacttcaaag taaataacac taacttattt gtacatccaa caagaagatc tcctttcaca

ggacaacacg aaaagcacaa aggggcctca gacattggca tctcaattat agacatctgg

tctctaaagc tttcacagaa ggatgcctcc acattgtggc caaccattcg aatgcacaca

cgggagttgt cgctcctctt actcctccaa ttcacgtaag cacgcaggaa tatagttttg

tttttctcct caattgctac cagatagtct cctaaaaaag gaagcaagat tgcatttgga

tcttagaatt acaaactcaa cgacttattt tgctgcctga aaatggaatg tataatataa

cacaggaatc actaactcaa agaaggaaca cagctgacat ctaagcaaca gcctctgagg

tgtg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (A>C, Chr. + strand; T>G, sense strand).

References

  1. Suzuki, T., Li, W., Zhang, Q., Novak, E. K., Sviderskaya, E. V., Wilson, A., Bennett, D. C., Roe, B. A., Swank, R. T., and Spritz, R. A. (2001) The Gene Mutated in Cocoa Mice, Carrying a Defect of Organelle Biogenesis, is a Homologue of the Human Hermansky-Pudlak Syndrome-3 Gene. Genom. 78, 30-37.

  2. Boissy, R. E., Richmond, B., Huizing, M., Helip-Wooley, A., Zhao, Y., Koshoffer, A., and Gahl, W. A. (2005) Melanocyte-Specific Proteins are Aberrantly Trafficked in Melanocytes of Hermansky-Pudlak Syndrome-Type 3. Am J Pathol. 166, 231-240.

  3. Richmond, B., Huizing, M., Knapp, J., Koshoffer, A., Zhao, Y., Gahl, W. A., and Boissy, R. E. (2005) Melanocytes Derived from Patients with Hermansky-Pudlak Syndrome Types 1, 2, and 3 have Distinct Defects in Cargo Trafficking. J Invest Dermatol. 124, 420-427.