Phenotypic Mutation 'Poppy' (pdf version)
Allele | Poppy |
Mutation Type |
missense
|
Chromosome | 13 |
Coordinate | 52,794,769 bp (GRCm39) |
Base Change | A ⇒ G (forward strand) |
Gene |
Syk
|
Gene Name | spleen tyrosine kinase |
Synonym(s) | Sykb |
Chromosomal Location |
52,737,209-52,802,828 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
|
Accession Number | Ncbi RefSeq: NM_011518.2, NM_001198977.1; MGI:99515
|
Mapped | Yes |
Amino Acid Change |
Tyrosine changed to Cysteine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000060828]
[ENSMUSP00000112914]
[ENSMUSP00000113852]
|
AlphaFold |
P48025 |
SMART Domains |
Protein: ENSMUSP00000060828 Gene: ENSMUSG00000021457 AA Change: Y501C
Domain | Start | End | E-Value | Type |
SH2
|
12 |
97 |
4.51e-26 |
SMART |
SH2
|
165 |
249 |
5.06e-29 |
SMART |
TyrKc
|
365 |
620 |
7.61e-120 |
SMART |
|
Predicted Effect |
possibly damaging
PolyPhen 2
Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000055087)
|
SMART Domains |
Protein: ENSMUSP00000112914 Gene: ENSMUSG00000021457 AA Change: Y478C
Domain | Start | End | E-Value | Type |
SH2
|
12 |
97 |
4.51e-26 |
SMART |
SH2
|
165 |
249 |
5.06e-29 |
SMART |
TyrKc
|
342 |
582 |
2.68e-106 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000118756)
|
SMART Domains |
Protein: ENSMUSP00000113852 Gene: ENSMUSG00000021457 AA Change: Y501C
Domain | Start | End | E-Value | Type |
SH2
|
12 |
97 |
4.51e-26 |
SMART |
SH2
|
165 |
249 |
5.06e-29 |
SMART |
TyrKc
|
365 |
620 |
7.61e-120 |
SMART |
|
Predicted Effect |
possibly damaging
PolyPhen 2
Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000120135)
|
Meta Mutation Damage Score |
0.5571 |
Is this an essential gene? |
Essential (E-score: 1.000) |
Phenotypic Category |
Autosomal Recessive |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All alleles(17) : Targeted(11) Gene trapped(6)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01478:Syk
|
APN |
13 |
52778784 |
missense |
probably benign |
0.00 |
IGL01522:Syk
|
APN |
13 |
52797097 |
missense |
probably benign |
|
IGL01957:Syk
|
APN |
13 |
52785776 |
missense |
probably benign |
|
IGL01962:Syk
|
APN |
13 |
52764993 |
missense |
probably damaging |
1.00 |
IGL02613:Syk
|
APN |
13 |
52797076 |
missense |
probably damaging |
0.97 |
IGL02824:Syk
|
APN |
13 |
52777319 |
splice site |
probably benign |
|
IGL03130:Syk
|
APN |
13 |
52776768 |
missense |
probably benign |
0.12 |
Apricot
|
UTSW |
13 |
52794769 |
missense |
probably damaging |
1.00 |
Sisyphus
|
UTSW |
13 |
52794826 |
missense |
probably damaging |
1.00 |
H8562:Syk
|
UTSW |
13 |
52794657 |
missense |
probably damaging |
1.00 |
R0091:Syk
|
UTSW |
13 |
52794769 |
missense |
probably damaging |
1.00 |
R0346:Syk
|
UTSW |
13 |
52794695 |
missense |
probably damaging |
1.00 |
R1888:Syk
|
UTSW |
13 |
52794826 |
missense |
probably damaging |
1.00 |
R1888:Syk
|
UTSW |
13 |
52794826 |
missense |
probably damaging |
1.00 |
R1917:Syk
|
UTSW |
13 |
52776744 |
missense |
probably damaging |
1.00 |
R2001:Syk
|
UTSW |
13 |
52765274 |
missense |
probably benign |
0.21 |
R2919:Syk
|
UTSW |
13 |
52765157 |
missense |
probably benign |
|
R3413:Syk
|
UTSW |
13 |
52785775 |
missense |
probably benign |
|
R3695:Syk
|
UTSW |
13 |
52776801 |
splice site |
probably null |
|
R4363:Syk
|
UTSW |
13 |
52794766 |
missense |
probably damaging |
1.00 |
R4754:Syk
|
UTSW |
13 |
52766295 |
intron |
probably benign |
|
R4755:Syk
|
UTSW |
13 |
52796022 |
missense |
probably benign |
0.25 |
R4806:Syk
|
UTSW |
13 |
52786963 |
missense |
probably benign |
0.14 |
R4817:Syk
|
UTSW |
13 |
52765242 |
missense |
probably benign |
0.03 |
R4903:Syk
|
UTSW |
13 |
52765117 |
missense |
probably damaging |
1.00 |
R4997:Syk
|
UTSW |
13 |
52766484 |
nonsense |
probably null |
|
R5066:Syk
|
UTSW |
13 |
52796018 |
missense |
possibly damaging |
0.49 |
R5114:Syk
|
UTSW |
13 |
52765071 |
missense |
probably damaging |
1.00 |
R5267:Syk
|
UTSW |
13 |
52795962 |
missense |
probably benign |
0.05 |
R5323:Syk
|
UTSW |
13 |
52785753 |
missense |
probably benign |
0.00 |
R5705:Syk
|
UTSW |
13 |
52765083 |
missense |
probably benign |
0.03 |
R6190:Syk
|
UTSW |
13 |
52765089 |
missense |
probably damaging |
0.97 |
R6892:Syk
|
UTSW |
13 |
52786934 |
missense |
probably benign |
0.00 |
R6932:Syk
|
UTSW |
13 |
52766495 |
splice site |
probably null |
|
R6977:Syk
|
UTSW |
13 |
52787094 |
missense |
probably benign |
0.00 |
R7496:Syk
|
UTSW |
13 |
52766452 |
missense |
probably benign |
|
R7650:Syk
|
UTSW |
13 |
52765131 |
missense |
probably benign |
0.24 |
R8081:Syk
|
UTSW |
13 |
52792195 |
missense |
probably benign |
0.00 |
R8199:Syk
|
UTSW |
13 |
52778768 |
missense |
probably benign |
0.00 |
R8350:Syk
|
UTSW |
13 |
52774935 |
missense |
probably damaging |
1.00 |
R8381:Syk
|
UTSW |
13 |
52787085 |
missense |
probably benign |
0.08 |
R8420:Syk
|
UTSW |
13 |
52778763 |
missense |
probably benign |
0.02 |
R8450:Syk
|
UTSW |
13 |
52774935 |
missense |
probably damaging |
1.00 |
R9177:Syk
|
UTSW |
13 |
52766480 |
missense |
probably benign |
0.37 |
R9689:Syk
|
UTSW |
13 |
52778808 |
missense |
probably benign |
|
Z1177:Syk
|
UTSW |
13 |
52786949 |
missense |
possibly damaging |
0.91 |
|
Mode of Inheritance |
Autosomal Recessive |
Local Stock | Live Mice |
MMRRC Submission |
036978-MU
|
Last Updated |
2019-10-23 1:57 PM
by Anne Murray
|
Record Created |
2013-02-01 12:40 AM
by Ying Wang
|
Record Posted |
2013-08-12 |
Phenotypic Description |
The poppy phenotype was initially identified by flow cytometric analysis of peripheral blood from G3 mice carrying mutations induced by N-ethyl-N-nitrosourea (ENU). The index poppy mice (T2313, T2314, and T2315) were deficient in B cells; neutrophil numbers were increased (Figure 1 & 2). Peritoneal macrophages from poppy mice exhibited hypersensitivity to the Toll-like receptor (TLR) agonists LPS, MALP2 and R848 as determined by increased secretion of TNFα compared to wild type macrophages (Figure 3).
|
Nature of Mutation | Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. Seventeen G3 mice from the poppy pedigree were genotyped at all 56 mutation sites. Among six mice with the poppy phenotype, five were homozygous and one was heterozygous for a mutation in Syk on chromosome 13. Among eleven unaffected mice, eight were either heterozygous or wild type at the Syk locus, while three were homozygous for the Syk mutation, indicating that the poppy phenotype is recessive and incompletely penetrant. These data resulted in a LOD score of 5.30. The mutation is an A to G transition at base pair 52640733 (v38) on Chromosome 13 in the GenBank genomic region NC_000079 encoding Syk. The mutation corresponds to residue 1718 in the NM_011518 mRNA sequence and 1714 in the NM_001198977 mRNA sequence within exon 11 of 14 total exons. NM_011518:
1702 CTGGTCACACAGCACTATGCCAAGATCAGCGAT
496 -L--V--T--Q--H--Y--A--K--I--S--D-
|
NM_001198977:
1698 CTGGTCACACAGCACTATGCCAAGATCAGCGAT
496 -L--V--T--Q--H--Y--A--K--I--S--D-
|
The mutated nucleotide is indicated in red. The mutation results in a tyrosine (Y) to cysteine (C) substitution at residue 501.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Syk encodes spleen tyrosine kinase (Syk), one of two members of the Syk family of cytosolic protein kinases. The second Syk family member is zeta-chain-associated protein kinase 70 (Zap70) (see the records for murdock, trebia, wanna, and mrtless). Syk and Zap70 both have two Src homology 2 (SH2) domains and a C-terminal kinase region followed by a short C-terminal tail [Figure 4; reviewed in (1-3)]. Between the SH2 domains is interdomain A; between the C-terminal SH2 domain and the kinase domain is interdomain B [(4); reviewed in (1-3)]. The SH2 domains recognize and bind diphosphorylated immunoreceptor tyrosine-based activation motifs (ITAMs; (Asp/Glu)-X-X-Tyr-X-X-Leu/Iso-(X)6-12-Tyr-X-X-Leu/Iso) or hemi-ITAMs (i.e,. contain one Tyr) in a target protein as well as β3-integrin (ITAM-independent) to initiate downstream signaling [reviewed in (1-3;5;6)]. The SH2 domains of Syk have a conformational flexibility that can recognize the relative distance between phosphotyrosines of an ITAM and adjust the orientation of the SH2 domains to fit that spacing [(7); reviewed in (5)]. The flexibility of the SH2 domains allows for Syk to interact with several different immunoreceptors (e.g., B- and T-cell antigen receptors and Natural Killer (NK)-cell receptors) and, possibly, some G-protein-coupled receptors [reviewed in (5)]. Interdomain A facilitates the proper conformation of the SH2 domains to promote binding to phosphorylated ITAMs using a helical coiled-coil structure [reviewed in (1;2)]. In addition, the C-terminal portion of interdomain A is critical for calcium mobilization via B cell receptor (BCR) signaling (8). Interdomain B contains five putative autophosphorylation sites and functions to recruit, and dock, downstream signaling proteins (e.g., phospholipase Cγ1 (PLCγ1), Vav1 and c-Cbl) as well as regulate the ability of Syk to bind to ITAMs [(9-13); reviewed in (1;2;14)]. Interdomain B also contains a non-canonical nuclear localization signal that permits Syk to shuttle between the nucleus and cytoplasm (15;16). A splice variant of Syk, SykB, lacks 23 amino acids of interdomain B, a sequence necessary for maximal ITAM binding by Syk [(12;15;17)]. SykB has comparable enzymatic activity to that of Syk, but is less efficient in coupling to phosphorylated ITAMs such as those of the FcγRI receptor of mast cells [(12); reviewed in (1;14)]. Syk Phosphorylation
Full-length Syk has ten autophosphorylation sites [out of 32 total phosphoacceptor sites (18)] with distinct functions (19):
-
Tyr130 within interdomain A is autophosphorylated upon BCR activation. Mutation of Tyr130 to a phenylalanine (Y130F) increased Syk ITAM binding and decreased the basal activity of Syk; substitution of Tyr130 to a glutamic acid (Y130E) decreased ITAM binding and increased kinase activity (20). Taken together, it is proposed that phosphorylation of Tyr130 mediates Syk activation and its subsequent release from the BCR (20).
-
Phosphorylation of Tyr290, within interdomain B, has no known function. Site-directed mutagenesis of Tyr290 to a phenylalanine (Y290F) resulted in lower expression levels of Syk when the mutant was expressed in RBL-2H3 cells, a basophilic leukemia cell line; Y290F Syk protein levels in BI-141 T cells were comparable to wild-type levels (12). In the RBL-2H3 cells, the Y290F mutant could rescue FcεRI-mediated degranulation in vitro to a similar extent as wild-type Syk (12). In the BI-141 cells, Y290F Syk responded at comparable levels to wild-type Syk in an antigen stimulation assay (12). Furthermore, analyses showed that T cell receptor (TCR)-induced protein tyrosine phosophorylation in the BI-141 cells expressing the Y290F mutant was indistinguishable from that in cells expressing wild-type Syk (12).
-
Autophosphorylation of another site within interdomain B, Tyr317, is proposed to function in the negative regulation of Syk activity by serving as a binding site for c-Cbl, a protein that ubiquitinates Syk and targets it for proteasome-mediated degradation (11;21-23). Signal transduction in B cells and mast cells is negatively regulated upon Tyr317 phosphorylation (10;23). Expression of a Tyr317 mutant (Y317F) resulted in an increase in FcεRI-induced degranulation as well as an increase in PLCγ1 and PLCγ2 phosphorylation (23). The corresponding residue in Zap70 (Tyr292) also binds c-Cbl (24) and is a negative-regulatory phosphorylation site [i.e.,dephosphorylation of Tyr292 is required for Zap70 activation] (21;25). Cells expressing a Zap70 Tyr292 mutant (Y292F) exhibit a hyperactive phenotype in T-cell receptor signaling (26).
-
Autophosphorylation of Tyr342 mediates the binding of Syk to the SH2 domain of Vav1, facilitating Syk-mediated phosphorylation of Vav1, a guanine nucleotide exchange factor for the Rho/Rac GTPases (27). Tyr342 and/or Tyr346 are required for the interaction of Syk and PLCγ1 via adaptor molecules such as LAT, SLP-76, or BLNK in immune cells (9;13;28;29). In addition to binding PLCγ1 in vitro, autophosphorylated Tyr346 has also been shown to bind to the SH2 domain of the P13K regulatory subunit, p85 (30). In vitro expression of a Syk mutant with mutations of both Tyr342 and Tyr346 (Y342F and Y356F, respectively) abrogated FcÉ›RI-induced degranulation of mast cells, calcium flux, phosphorylation of PLCγ1, PLCγ2, LAT, SLP76, and Vav1 as well as AKT and ERK activation (11). Comparison of mast cells expressing either the Y342F or Y346F mutant determined that ERK and AKT activation is more dependent on Tyr346 than Tyr342 (11). Mutant Syk (Y342F, Y346F) was not constitutively active in an IgM-BCR-expressing B-cell line, but could be activated by the BCR (31). In contrast, a mutant Syk with both Tyr342 and Tyr346 mutated to glutamic acid was more active in phosphorylating SLP-65 than wild-type Syk (31).
-
In vitro analysis determined that Tyr358 is autophosphorylated, although the function is unknown (19).
-
Within the activation loop of the kinase domain, Tyr519 and Tyr520 are autophosphorylated following Syk binding to phosphorylated ITAMs. Similar Tyr residues are found in activation loops of other protein tyrosine kinases, including Zap70 and the insulin receptor. In the case of the insulin receptor, dephosphorylated Tyr1162 within the activation loop physically blocks ATP binding to the active site (32). Phosphorylation of Tyr1162 relieves the inhibition, allowing for kinase activation (32). Phosphorylation of Tyr519 and Tyr520 is required for Syk signal transduction including, although not absolutely required for Syk kinase activity (33;34). Activation loop autophosphorylation sustains Syk signaling after transient ITAM phosphorylation ends (35).
-
Phosphorylated Tyr624 binds to the SH2 domain of SLP-65, an association essential for BCR signaling and B cell development (31).
-
Tyr623, Tyr624, and Tyr625 maintain Syk in an inactive form (36;37). Expression of a Syk mutant in which these three sites were mutated to phenylalanines led to increased TCR signaling in Jurkat T cells (36;37). Upon autophosphorylation, the Tyr-mediated autoinhibitory interactions are disrupted, resulting in an open, active conformation (19;37).
The Syk kinases are maintained in a closed, inactive conformation by interactions between residues in interdomain A, interdomain B, and the kinase domain (36;38;39). The C-terminal region of interdomain A contains residues important for maintaining the resting state [(8); reviewed in (2)]. In the inactive conformation, the SH2 domains are not aligned for ITAM binding and the kinase domain cannot perform the phospho-transfer reaction (36). Either phosphorylation of interdomain A/B tyrosines or binding of phosphorylated ITAMs to SH2 domains can release the inhibitory interactions that hold Syk in an inactive state, thereby permitting ATP and substrates access to the active site and stimulating Syk kinase activity (36;37;39). The crystal structure of the kinase domain of human Syk (amino acids 353-635) has been solved [Figure 5; PDB: 1XBA; (40)]. The N-terminal lobe of the kinase domain is composed of a five-stranded β-sheet and a single α-helix, while the C-terminal lobe is largely α-helical with three short β-strands; the active site is between the two lobes (40). Unphosphorylated Syk kinase domain forms a loop-out conformation similar to what is seen in active, phosphorylated protein kinases, indicating that activation loop phosphorylation is not required for Syk kinase activity. A recent study crystalized full-length human Syk at 2.2 Å [Figure 6; PDB:4FL3; (41)]. In this structure, the topology of the Syk kinase domain is similar to inactive kinase domains. The interdomain linkers (helices αL1, αL2, and αL3) bind to helices αE and αI of the kinase domain, consistent with previous data supporting an autoinhibited conformation maintained by interactions between interdomains A and B, and the kinase domain. The SH2 domains each consist of a β-sheet flanked by two α-helices and the linkers consist of three α-helices to form a helical coiled coil (41). The poppy mutation is a tyrosine to cysteine substitution at amino acid 501 within the C-terminal kinase domain.
|
Expression/Localization | Syk is highly expressed in hematopoietic cells including B cells, immature T cells, mast cells, dendritic cells, basophils, osteoclasts, leukocytes, neutrophils, macrophages, and platelets [reviewed in (1-3)]. Syk is also expressed in non-hematopoietic cells including fibroblasts (embryonic and nasal), epithelial cells (breast and airway), hepatocytes, neuronal cells, and vascular endothelial cells, red blood cells, and synoviocytes (4). In B cells, Syk is localized to both nuclear and cytoplasmic compartments [reviewed in (1)]. The mechanism by which Syk is transported between the nucleus and cytoplasm is unknown, but interdomain B is essential for this to occur (16). Upon BCR aggregation, Syk is recruited to the plasma membrane [(42); reviewed in (1)]. Reduction in Syk mRNA and protein expression has been documented in several types of cancers including breast, gastric, melanoma, squamous cell carcinoma, pro-B cell acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), and chronic lymphocytic leukemia (CLL) [(43-47); reviewed in (48)].
|
Background |
Syk plays a major role in B cell development as a component of the pre-BCR and BCR signaling pathways, and no mature B cells are found in mice with targeted null mutations of Syk (49-51). In BCR signaling, following the aggregation of BCR molecules, the ITAMs in the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) [Figure 7; (52;53)]. These phosphotyrosines then act as docking sites for the SH2 domains of Syk, resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including BLNK (see the record for busy), PLCγ2 (see the record for queen), and protein kinase C β (PKCβ; see the record for Untied). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of PIP3, which binds selectively to the pleckstrin homology domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLCγ2, which results in the additional phosphorylation and activation of PLCγ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (54). The recruitment of Vav1, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed in (55)]. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for puff, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (56)]. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (Malt1), and caspase recruitment domain family, member 11 (CARMA1, alternatively Card11; see the record for king), which are involved in NF-κB activation along with PKCβ (57-60). Syk couples pre-BCR and BCR activation to downstream signaling pathways that mediate B cell development, proliferation, and survival (Figure 7). Pre-BCR engagement results in the activation of Syk, which together with Src-family kinases (Lyn, Fyn, Blk), phosphorylates many substrates (see Table 1) and triggers signaling pathways that are involved in both proliferation and differentiation of pre-B cells (52;53). These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP; see the record for sothe) (61). PI3K activation results in the generation of phosphatidylinositol-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3-phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway suppresses recombination-activating gene 1 (RAG1; see the record for maladaptive) and RAG2 expression (in VDJ recombination in pro-B cells), blocks Igκ (the kappa chain of the immunoglobin light chain) gene recombination, and induces cell proliferation. Syk also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and PLCγ2 (54). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igκ recombination. SLP65 also modulates PKB activity either directly or by altering the activity of Syk, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP; see the record for styx) and altering PIP3 levels. Table 1. Select substrates of Syk* [modified from (1)]
|
Substrate
|
Associated Mutagenetix entry
|
Description of Syk-associated function
|
Refs
|
Enzymes
|
P85 subunit of PI3K
|
none
|
Generates membrane-associated PIP3 as well as mediates Akt activity in B cells after BCR engagement and in B cells exposed to oxidative stress
|
(30;62)
|
c-Cbl
|
none
|
Ubiquitinates Syk, promoting Syk degradation
|
(21;22;63)
|
PLCγ2
|
queen
|
Activates MAP kinase cascades such as JNK, p38 and ERK in BCR-coupled signaling and in platelet activation
|
(64-66)
|
Btk
|
none
|
Controls downregulation of l-5, a component of the surrogate light chain, and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4) in B-cell development, differentiation, and signaling
|
(28;65;67;68)
|
Vav1
|
none
|
Activates MAP kinase cascades such as JNK, p38 and ERK in BCR-coupled signaling
|
(27;69)
|
MAPKs (JNK, p38 MAPK, p44/p42 MAPK)
|
none
|
TNF-coupled signaling; cytoskeletal function (Rac/Rho pathway); Ca2+ entry and activation of PKC (IP3 and DAG pathway)
|
(64;70)
|
Phospholipase D (PLD)
|
none
|
BCR-associated signaling to mediate B cell survival and proliferation
|
(65)
|
Adaptor molecules
|
LAT
|
none
|
Activates PLCγ1 and Ras pathways in the T cell; regulates PLCγ2 in platelet activation via CLEC2
|
(29;66;71)
|
SLP-76 (alternatively, LCP2)
|
none
|
Regulates blood and lymphatic vascular separation, bone reabsorption by osteoclasts, and platelet activation
|
(72-74)
|
BLNK (alternatively, SLP-65)
|
busy
|
Facilitates binding of Vav1, Btk, and PLCγ to Syk in B cell activation
|
(28;75;76)
|
BCAP and CD19
|
sothe
|
Activates the PI3K pathway to control proliferation and B cell survival
|
(61;77)
|
HS1 (alternatively, Hcls1)
|
none
|
Facilitates actin assembly to lipid rafts and antigen presentation in B cells as well as platelet activation after GPVI stimulation
|
(78-80)
|
Card9
|
none
|
Links receptor-mediated recognition of fungal pathogens and the NF-κB pathway in macrophages and dendritic cells; functions in Syk-mediated pro-IL1-β synthesis by the Nlrp3 inflammasome (see the record for ND1)
|
(81;82)
|
CARMA1 (alternatively, Card11)
|
king
|
Regulates NF-κB activation by antigen receptors in lymphocytes
|
(83)
|
Shc
|
none
|
Activates the Ras/MAPK cascade after FcεRI mast cell receptor activation
|
(84)
|
CD3ζ
|
allia
|
Mediates neuronal morphogenesis via the ephrin A pathway (see the record for frog)
|
(85)
|
3BP2 (alternatively, Sh3bp2)
|
none
|
Mediates BCR-mediated activation of nuclear factor of activated T cells (NF-AT)
|
(86;87)
|
MyD88
|
pococurante
|
Recruits c-Cbl resulting in attenuation of CD11b-integrin TLR-triggered responses
|
(88)
|
TRIF
|
Lps2
|
*List is not comprehensive
Syk in other immune cell ITAM pathways
In addition to its role in BCR signaling, Syk also functions in pre-TCR signaling in thymocytes during the transition from the DN3 to the DN4 stage of development (89), and during TCR signaling in mature T cell populations (intraepithelial γδ T cells and naïve αβ T cells) (Table 2) (90;91). However, Zap70 is the major Syk family kinase in TCR signaling. Syk functions in ITAM-associated signaling in other immune cells including natural killer cells downstream from the FcγRIII receptor (92), in mast cells downstream from the FcεRI receptor (11;13), and in neutrophils and macrophages downstream from FcγR signaling [Figure 8 and Table 2; (93;94)]. Although ligand recognition differs among these receptors, the intracellular pathways are highly conserved: activated Src family kinases (e.g., Hck, Fgr, Lyn, or Src) recruit Syk to the receptor-associated ITAMs [reviewed in (3;95)]. Activated Syk subsequently phosphorylates a number of proteins including SLP76, SLP65, Vav1, PLCγ, and the p85α subunit of PI3K (see Table 1). These proteins activate downstream signaling components to trigger several cellular responses including proliferation, differentiation, cell survival, mast cell degranulation, reactive oxygen species (ROS) production, phagocytosis, and cytokine release [reviewed in (2;3)]. A role for Syk in numerous non-immune cells has also been demonstrated (Table 2). Syk signaling via hemi-ITAMs
Syk can also bind to hemi-ITAMs (i.e., ITAM motifs containing one YxxL motif) in C-type lectin receptors including the C-type lectin-like protein type 2 (CLEC2) receptor, CLEC9A, and Dectin-1 (96). CLEC2 functions in the developmental separation of blood and lymphatic vessels (97;98), while Dectin-1 induces intracellular signaling upon recognition of fungal pathogens (99). The C-type lectin and BCR signaling pathways share many of the same downstream components, including PLCγ2 (96). Syk-associated signaling via ITAM-signaling adaptors
Syk can also signal through ITAM-containing adaptors (e.g., DNAX activation protein-12 (DAP12) and FcRγ) that associate with immunoglobulin superfamily-containing proteins [e.g., Fc receptors, PIR-A, OSCAR, GPVI, or triggering receptor expressed on myeloid cells (TREM) (100;101)], C-type lectin receptors [e.g., Dectin-2, Mincle, or MDL-1 (102;103)], and cytokine receptors [e.g., macrophage colony-stimulating factor (M-CSF) (104;105)], as well as integrins (106;107). DAP12, FcRγ, and their associated receptors are found in several cell types including neutrophils, macrophages, monocytes, dendritic cells, basophils, eosinophils, mast cells, NK cells, microglia, osteoclasts, megakaryocytes, and platelets [reviewed in (108)]. Signaling via the ITAM-containing adaptors and their associated receptors is similar to ITAM receptor signaling. Syk-mediated activation of PLCγ2 and CARD9 leads to the activation of NF-κB and MAPKs [reviewed in (109)]. Signaling via the ITAM-signaling adaptors mediates phagocytosis (110) and osteoclast development (111) as well as cell proliferation and survival (105). The ITAM-associated receptors and TLRs activate distinct signaling pathways, but the two pathways can cross-talk to activate NF-κB and the MAPKs. For example, Syk activation and association with DAP12-TREM can either amplify or dampen TLR-induced signals in a ligand-dependent manner during an inflammatory response, possibly through the CARD complex or the activation of ERK (112). ITAM-independent signaling
Integrins are known to signal via Syk in a pathway similar to that used by ITAM-associated immunoreceptors. For example, in platelets, activation of αIIbβ3 integrin (in association with the ITAM-containing receptor FcγRIIA) can activate Syk, subsequently leading to platelet activation through SLP76 and PLCγ2 [reviewed in (3)]. However, some evidence suggests that integrins activate Syk in an ITAM-independent manner, through direct binding between Syk and the integrin β chain [reviewed in (3)]. Table 2. Syk is a multi-functional kinase [modified from (5)]
Cell type
|
Syk-associated receptor
|
Signaling adaptor
|
Cellular activity supported by Syk
|
Refs
|
Effector T cells
|
TCR
|
CD3ζ
|
Self-antigen presentation to B cells
|
(113)
|
NK cells
|
FcγRIIIa
|
DAP12
|
Surveillance of genotoxic stress/transformation and mitotic cells as well as elimination of antibody coated cells
|
(114)
|
B cells
|
BCR or FcgRIIB
|
Igα and Igβ
|
Pre-B cell development and activation via the BCR; inhibition of B cell activation via the FcgRIIB receptor
|
(49;115;116)
|
Red blood cells
|
|
|
Phosphorylation of band 3 protein; cell removal from circulation, glycolysis, cell shape, membrane transport
|
(113)
|
Neutrophils
|
FcγR1; FcγRII; FcεR1; FcγRIII; integrins
|
FCRγ
|
Cell adhesion and phagocytosis as well as degranulation and cell spreading in response to proinflammatory stimuli
|
(93;107;117)
|
Basophils
|
FcεRI
|
FcRγ; FcRβ
|
Degranulation
|
(118;119)
|
Eosinophils
|
FcγR; FcεR
|
FcRγ
|
Degranulation and reactive oxygen intermediates generation
|
(120)
|
Macrophages
|
FcgR1; FcγRII; FcεR1; integrins
|
|
Cell adhesion and phagocytosis as well as degranulation and cell spreading in response to proinflammatory stimuli
|
(93;94)
|
Mast cells
|
FcεRI
|
FcRγ; FcRβ
|
Degranulation and cytokine production
|
(121;122)
|
Dendritic cells
|
FcRs
|
DAP12
|
Antigen internalization, presentation, cell maturation
|
(123)
|
Osteoclasts
|
RANK; TREM2
|
DAP12; FcRγ
|
Osteoclastogenesis; bone resorption
|
(106;111)
|
Platelets
|
GpVI; CLEC2; αIIbβ3 integrin
|
FcRγ
|
Spreading, aggregation, and serotonin secretion
|
(124-126)
|
Embryonic fibroblasts
|
|
G protein
|
Differentiation to adipocytes
|
(4)
|
Nasal fibroblasts
|
|
|
LPS-induced RANTES production; IL-1 induced chemokine production
|
(4;127)
|
Synoviocytes
|
TNFR
|
|
TNF-α induced JNK activation, metalloprotease 3 gene expression, matrix degradation and synovial fluid regulation
|
(128)
|
Breast epithelial cells
|
|
|
Controls cell division
|
(4;47;48)
|
Airway epithelial cells
|
β1-integrin
|
|
Expression of ICAM-1 and IL-6
|
(129)
|
Hepatocytes
|
AT1; AT2
|
G protein
|
ERK activation; glycogen granule accumulation
|
(4;130)
|
Smooth muscle
|
AT1; AT2
|
G protein
|
Protein synthesis; cell migration
|
(4)
|
Vascular endothelial cells
|
|
|
Cell growth, migration, survival; separation of lymphatic vessels from blood vessels
|
(4;131)
|
Neuronal
|
|
CD3ζ?
|
Neuronal differentiation and neurite extension
|
(4)
|
Melanocytes
|
|
|
Metastatic behavior regulation
|
(132)
|
Syk in human disease
Syk signaling affects several tumor cell activities including cell division, cell survival, 3-D cell outgrowth, cell migration, neuron-like cell differentiation, phagocytosis, and cell adhesion (47;48;133;134). Syk is expressed in human breast tissue and benign breast tumors, but is undetectable or expressed at low levels in invasive breast tumors and cell lines (47). Syk transfection into a Syk-negative breast cancer cell line resulted in inhibition of tumor growth and metastasis in athymic mice (47). In addition, overexpression of a kinase-deficient Syk in a Syk-expressing breast cancer cell line increased the incidence and growth of tumors (47). Thus, Cooper et al. propose that Syk functions as a tumor suppressor in human breast carcinomas (47). Consistent with this hypothesis, reduced amounts of SYK mRNA expression in breast cancer tissue relative to adjacent non-cancerous tissue were correlated with increased incidence of distant metastasis, translating to poor prognosis (135). Syk has been shown to regulate mammalian target of rapamycin (mTOR) and MAPK signaling in AML (44) and in B cell lymphoma (48;49). Syk is activated in CLL (45;46), a condition characterized by the expansion of monoclonal, mature B cells [reviewed in (136)], and regulates the survival of CLL B cells (137). Syk inhibition can suppress CLL B cell activation and migration (43). Defects in Syk-associated signaling are linked to autoimmune and allergic diseases such as rheumatoid arthritis, asthma, and allergic rhinitis [(138;139); reviewed in (140)]. Syk null mouse models
Syk deficiency in homozygous Syk knockout mouse models (MGI:1857421, MGI:2384078, and MGI: 3690645) leads to the absence of mature B cells due to abnormal B cell differentiation (49-51). Homozygotes exhibited early postnatal lethality (49;51) with a concomitant defect in blood vessel morphology, dilated vasculature, and systemic hemorrhage in the embryo (49;51;98;141). Further observation of homozygous Syktm1Tyb mice (MGI:2384078) found that the model exhibited defective osteoclast differentiation (111), decreased bone resorption (111), decreased TNF secretion from neutrophils after 16-hour culture with S. aureus or E. coli (142), impaired lymphatic vessel morphology in the lungs and brain [i.e., there is a connection between the vasculature and lymphatic systems; (98)], impaired neutrophil degranulation in response to S. aureus and E. coli (142), impaired neutrophil phagocytosis of bacteria (142), reduced T cell number in the skin (49), and inefficient CD8α+ dendritic cell antigen cross-presentation (143).
|
Putative Mechanism | Consistent with an essential role for Syk in BCR signaling, B cell proliferation, and B cell differentiation (49;50;144), homozygous poppy mice are B cell-deficient. However, homozygous poppy mice are born at expected Mendelian ratios and survive to adulthood, indicating that the poppy allele retains sufficient functionality to support postnatal survival. The role of Syk in TLR-mediated signaling is unclear. The poppy mutation results in an increase in macrophage TNFα secretion upon treatment with the TLR agonists MALP2 (TLR2/6) and R848 (TLR7). Studies have documented elevated TLR4-, TLR3-, and TLR9-mediated signaling in Syk-deficient macrophages, leading to a subsequent increase in TNF production relative to wild type macrophages (145). However, the role of Syk in TLR2/6, TLR7 or TLR8 signaling has not been documented. Some evidence suggest that TLR or TNF receptor activation leads to integrin activation [(88;146); reviewed in (109)], subsequently causing the integrins to assume a conformation that promotes high-affinity ligand-binding in a process known as ‘inside-out’ signaling (147;148). Inside-out signaling promotes increased adhesion to the extracellular matrix, cell spreading and enhanced cell-cell interactions. The increased integrin ligand affinity also results in high-avidity ligation of integrins and the subsequent generation of an integrin-mediated ‘outside-in’ signal. The outside-in signal of β2 and β3 integrins is propagated by DAP12 and FcRγ, which recruit Syk to their phosphorylated ITAMs. Published data currently support two distinct mechanisms by which Syk may negatively regulate TLR signaling. First, Syk interacts with, and induces the phosphorylation of, the TLR adapters MyD88 and TRIF (88). Phosphorylation of MyD88 and TRIF subsequently results in c-Cbl-induced ubiquitination and degradation of Syk (88). Second, β2 integrins and FcγRs in macrophages signal via the ITAM-containing adaptor DAP12 and Syk to inhibit TLR signaling through the induction of IL-10 and the TLR signaling inhibitors SOCS3, ABIN-3, and A20 (149). Notably, DAP12-deficient macrophages also displayed elevated TNF production in response to TLR ligands (145), supporting a DAP12 negative regulatory signaling cascade involving Syk that inhibits TLR signaling. These findings contrast with data supporting a positive role for Syk in TLR signaling. In one study, Syk phosphorylation was induced in THP1 human monocytes upon TLR9 activation, subsequently leading to cell migration, adhesion, and secretion of IFNα and IL-6 (150). In another study, LPS stimulation of murine macrophages induced Syk phosphorylation and the expression of inflammatory genes (151). Piceatannol, a Syk inhibitor, as well as Syk inhibition by antisense oligonucleotides resulted in attenuation of the LPS-induced events in macrophages (151;152). Lin et al. examined the role of Syk in TLR9, -3, and -4-mediated signaling by using Syk inhibitors (SykI and BAY61-3606) in TLR-stimulated RAW 264.7 macrophages and primary bone marrow-derived macrophages (BMDM) (153). They found that pharmacological inhibition of Syk in the RAW 264.7 macrophages resulted in an inhibitory effect on TLR-induced JNK activation and the attenuation of inflammatory gene expression (iNOS and COX2); IKK, p38 and ERK activation were not changed (153). However, siRNA-mediated knockdown of Syk in RAW 264.7 cells followed by treatment with LPS, CpG, or poly(I:C) did not result in changes to JNK activation although there was an observed increase in iNOS and COX-2 expression (153). Chaudhary et al. treated human monocyte THP-1 cells with piceatannol and found that Syk activity is necessary for TLR4 tyrosine phosphorylation upon LPS stimulation and that piceatannol treatment results in an inhibition of IL-10 and IL-12 release from the THP-1 cells upon LPS stimulation (154).
|
Primers |
PCR Primer
Poppy_pcr_F: CCGCCGTCCACTCTTGGTAATG
Poppy_pcr_R: TGTTTCAAAGCAAGTTGACGCAAGC
|
Genotyping | Poppy genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing. PCR Primers
Poppy(F): 5’- CCGCCGTCCACTCTTGGTAATG-3’
Poppy(R): 5’- TGTTTCAAAGCAAGTTGACGCAAGC-3’
Sequencing Primer
Poppy_seq(F): 5’- CAGGTTTCCATGGGGATGAA-3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40X
6) 72°C 10:00
7) 4°C ∞ The following sequence of 797 nucleotides (from Genbank genomic region NC_000079 for the linear DNA sequence of Syk) is amplified: 57130 c cgccgtccac tcttggtaat gatgtcgtgt gattctaggc acattaagga
57181 taagaacatc atagagctgg ttcaccaggt ttccatgggg atgaagtatt tggaagagag
57241 caactttgtg cacagagatc tggctgcgcg gaacgtgctt ctggtcacac agcactatgc
57301 caagatcagc gatttcggtc tttccaaagc cctgcgtgct gatgaaaact actacaaggt
57361 aggagcgctc ggtgcaagct cacagaacag ggagaggaaa cagctctgtg caggctcacg
57421 gagcaggctg agagctcagt acaggctcac agagcagctg aggggacagc ttccatgcat
57481 agttaaggtt gcaggttata aagatataga aagataaatg tgtgctctct gtattttact
57541 atggtagaaa tctcactagt aaccttggag aaaagtattc ttaagatcga ttctgtccat
57601 caagaaacac aaaccaaaaa tactgtaatg tttctcaact ggaatctttt tcagactagg
57661 atcttatgtt gagttttttg gtggtggtgg tggttttttt tttttttttt ttcgttttac
57721 atttacttat cttgctctgt gtatggagtc atgtgtgccg tagtgttcta atagagagca
57781 gaggacaact tacagaagtt gattctctcc atctaccatg catatcggag gaatcgaact
57841 ctgatcttcg gattcggcag caggcacctt acccattgag ccatcttgct ggcctctaaa
57901 tgcttgcgtc aacttgcttt gaaaca Primer binding sites are underlined and the sequencing primer is highlighted; the mutated A is shown in red text.
|
References |
14. Turner, M., Schweighoffer, E., Colucci, F., Di Santo, J. P., and Tybulewicz, V. L. (2000) Tyrosine Kinase SYK: Essential Functions for Immunoreceptor Signalling. Immunol Today. 21, 148-154.
15. Wang, L., Duke, L., Zhang, P. S., Arlinghaus, R. B., Symmans, W. F., Sahin, A., Mendez, R., and Dai, J. L. (2003) Alternative Splicing Disrupts a Nuclear Localization Signal in Spleen Tyrosine Kinase that is Required for Invasion Suppression in Breast Cancer. Cancer Res. 63, 4724-4730.
16. Zhou, F., Hu, J., Ma, H., Harrison, M. L., and Geahlen, R. L. (2006) Nucleocytoplasmic Trafficking of the Syk Protein Tyrosine Kinase. Mol Cell Biol. 26, 3478-3491.
18. Bohnenberger, H., Oellerich, T., Engelke, M., Hsiao, H. H., Urlaub, H., and Wienands, J. (2011) Complex Phosphorylation Dynamics Control the Composition of the Syk Interactome in B Cells. Eur J Immunol. 41, 1550-1562.
19. Furlong, M. T., Mahrenholz, A. M., Kim, K. H., Ashendel, C. L., Harrison, M. L., and Geahlen, R. L. (1997) Identification of the Major Sites of Autophosphorylation of the Murine Protein-Tyrosine Kinase Syk. Biochim Biophys Acta. 1355, 177-190.
21. Lupher, M. L.,Jr, Rao, N., Lill, N. L., Andoniou, C. E., Miyake, S., Clark, E. A., Druker, B., and Band, H. (1998) Cbl-Mediated Negative Regulation of the Syk Tyrosine Kinase. A Critical Role for Cbl Phosphotyrosine-Binding Domain Binding to Syk Phosphotyrosine 323. J Biol Chem. 273, 35273-35281.
22. Yankee, T. M., Keshvara, L. M., Sawasdikosol, S., Harrison, M. L., and Geahlen, R. L. (1999) Inhibition of Signaling through the B Cell Antigen Receptor by the Protooncogene Product, c-Cbl, Requires Syk Tyrosine 317 and the c-Cbl Phosphotyrosine-Binding Domain. J Immunol. 163, 5827-5835.
25. Bottini, N., Stefanini, L., Williams, S., Alonso, A., Jascur, T., Abraham, R. T., Couture, C., and Mustelin, T. (2002) Activation of ZAP-70 through Specific Dephosphorylation at the Inhibitory Tyr-292 by the Low Molecular Weight Phosphotyrosine Phosphatase (LMPTP). J Biol Chem. 277, 24220-24224.
26. Kong, G., Dalton, M., Bubeck Wardenburg, J., Straus, D., Kurosaki, T., and Chan, A. C. (1996) Distinct Tyrosine Phosphorylation Sites in ZAP-70 Mediate Activation and Negative Regulation of Antigen Receptor Function. Mol Cell Biol. 16, 5026-5035.
27. Deckert, M., Tartare-Deckert, S., Couture, C., Mustelin, T., and Altman, A. (1996) Functional and Physical Interactions of Syk Family Kinases with the Vav Proto-Oncogene Product. Immunity. 5, 591-604.
29. Finco, T. S., Kadlecek, T., Zhang, W., Samelson, L. E., and Weiss, A. (1998) LAT is Required for TCR-Mediated Activation of PLCgamma1 and the Ras Pathway. Immunity. 9, 617-626.
30. Moon, K. D., Post, C. B., Durden, D. L., Zhou, Q., De, P., Harrison, M. L., and Geahlen, R. L. (2005) Molecular Basis for a Direct Interaction between the Syk Protein-Tyrosine Kinase and Phosphoinositide 3-Kinase. J Biol Chem. 280, 1543-1551.
33. Kurosaki, T., Johnson, S. A., Pao, L., Sada, K., Yamamura, H., and Cambier, J. C. (1995) Role of the Syk Autophosphorylation Site and SH2 Domains in B Cell Antigen Receptor Signaling. J Exp Med. 182, 1815-1823.
35. Carsetti, L., Laurenti, L., Gobessi, S., Longo, P. G., Leone, G., and Efremov, D. G. (2009) Phosphorylation of the Activation Loop Tyrosines is Required for Sustained Syk Signaling and Growth Factor-Independent B-Cell Proliferation. Cell Signal. 21, 1187-1194.
37. Zeitlmann, L., Knorr, T., Knoll, M., Romeo, C., Sirim, P., and Kolanus, W. (1998) T Cell Activation Induced by Novel Gain-of-Function Mutants of Syk and ZAP-70. J Biol Chem. 273, 15445-15452.
38. Deindl, S., Kadlecek, T. A., Brdicka, T., Cao, X., Weiss, A., and Kuriyan, J. (2007) Structural Basis for the Inhibition of Tyrosine Kinase Activity of ZAP-70. Cell. 129, 735-746.
39. Tsang, E., Giannetti, A. M., Shaw, D., Dinh, M., Tse, J. K., Gandhi, S., Ho, H., Wang, S., Papp, E., and Bradshaw, J. M. (2008) Molecular Mechanism of the Syk Activation Switch. J Biol Chem. 283, 32650-32659.
40. Atwell, S., Adams, J. M., Badger, J., Buchanan, M. D., Feil, I. K., Froning, K. J., Gao, X., Hendle, J., Keegan, K., Leon, B. C., Muller-Dieckmann, H. J., Nienaber, V. L., Noland, B. W., Post, K., Rajashankar, K. R., Ramos, A., Russell, M., Burley, S. K., and Buchanan, S. G. (2004) A Novel Mode of Gleevec Binding is Revealed by the Structure of Spleen Tyrosine Kinase. J Biol Chem. 279, 55827-55832.
41. Gradler, U., Schwarz, D., Dresing, V., Musil, D., Bomke, J., Frech, M., Greiner, H., Jakel, S., Rysiok, T., Muller-Pompalla, D., and Wegener, A. (2013) Structural and Biophysical Characterization of the Syk Activation Switch. J Mol Biol. 425, 309-333.
42. Ma, H., Yankee, T. M., Hu, J., Asai, D. J., Harrison, M. L., and Geahlen, R. L. (2001) Visualization of Syk-Antigen Receptor Interactions using Green Fluorescent Protein: Differential Roles for Syk and Lyn in the Regulation of Receptor Capping and Internalization. J Immunol. 166, 1507-1516.
43. Hoellenriegel, J., Coffey, G. P., Sinha, U., Pandey, A., Sivina, M., Ferrajoli, A., Ravandi, F., Wierda, W. G., O'Brien, S., Keating, M. J., and Burger, J. A. (2012) Selective, Novel Spleen Tyrosine Kinase (Syk) Inhibitors Suppress Chronic Lymphocytic Leukemia B-Cell Activation and Migration. Leukemia. 26, 1576-1583.
44. Carnevale, J., Ross, L., Puissant, A., Banerji, V., Stone, R. M., Deangelo, D. J., Ross, K. N., and Stegmaier, K. (2013) SYK Regulates mTOR Signaling in AML. Leukemia. .
45. Fruchon, S., Kheirallah, S., Al Saati, T., Ysebaert, L., Laurent, C., Leseux, L., Fournie, J. J., Laurent, G., and Bezombes, C. (2012) Involvement of the Syk-mTOR Pathway in Follicular Lymphoma Cell Invasion and Angiogenesis. Leukemia. 26, 795-805.
46. Leseux, L., Hamdi, S. M., Al Saati, T., Capilla, F., Recher, C., Laurent, G., and Bezombes, C. (2006) Syk-Dependent mTOR Activation in Follicular Lymphoma Cells. Blood. 108, 4156-4162.
47. Coopman, P. J., Do, M. T., Barth, M., Bowden, E. T., Hayes, A. J., Basyuk, E., Blancato, J. K., Vezza, P. R., McLeskey, S. W., Mangeat, P. H., and Mueller, S. C. (2000) The Syk Tyrosine Kinase Suppresses Malignant Growth of Human Breast Cancer Cells. Nature. 406, 742-747.
49. Turner, M., Mee, P. J., Costello, P. S., Williams, O., Price, A. A., Duddy, L. P., Furlong, M. T., Geahlen, R. L., and Tybulewicz, V. L. (1995) Perinatal Lethality and Blocked B-Cell Development in Mice Lacking the Tyrosine Kinase Syk. Nature. 378, 298-302.
50. Saijo, K., Schmedt, C., Su, I. H., Karasuyama, H., Lowell, C. A., Reth, M., Adachi, T., Patke, A., Santana, A., and Tarakhovsky, A. (2003) Essential Role of Src-Family Protein Tyrosine Kinases in NF-kappaB Activation during B Cell Development. Nat Immunol. 4, 274-279.
51. Cheng, A. M., Rowley, B., Pao, W., Hayday, A., Bolen, J. B., and Pawson, T. (1995) Syk Tyrosine Kinase Required for Mouse Viability and B-Cell Development. Nature. 378, 303-306.
53. Rolli, V., Gallwitz, M., Wossning, T., Flemming, A., Schamel, W. W., Zurn, C., and Reth, M. (2002) Amplification of B Cell Antigen Receptor Signaling by a Syk/ITAM Positive Feedback Loop. Mol Cell. 10, 1057-1069.
54. Hashimoto, S., Iwamatsu, A., Ishiai, M., Okawa, K., Yamadori, T., Matsushita, M., Baba, Y., Kishimoto, T., Kurosaki, T., and Tsukada, S. (1999) Identification of the SH2 Domain Binding Protein of Bruton's Tyrosine Kinase as BLNK--Functional Significance of Btk-SH2 Domain in B-Cell Antigen Receptor-Coupled Calcium Signaling. Blood. 94, 2357-2364.
57. Hara, H., Wada, T., Bakal, C., Kozieradzki, I., Suzuki, S., Suzuki, N., Nghiem, M., Griffiths, E. K., Krawczyk, C., Bauer, B., D'Acquisto, F., Ghosh, S., Yeh, W. C., Baier, G., Rottapel, R., and Penninger, J. M. (2003) The MAGUK Family Protein CARD11 is Essential for Lymphocyte Activation. Immunity. 18, 763-775.
58. Ruland, J., Duncan, G. S., Elia, A., del, B. B.,I, Nguyen, L., Plyte, S., Millar, D. G., Bouchard, D., Wakeham, A., Ohashi, P. S., and Mak, T. W. (2001) Bcl10 is a Positive Regulator of Antigen Receptor-Induced Activation of NF-kappaB and Neural Tube Closure. Cell. 104, 33-42.
59. Newton, K., and Dixit, V. M. (2003) Mice Lacking the CARD of CARMA1 Exhibit Defective B Lymphocyte Development and Impaired Proliferation of their B and T Lymphocytes. Curr Biol. 13, 1247-1251.
60. Egawa, T., Albrecht, B., Favier, B., Sunshine, M. J., Mirchandani, K., O'Brien, W., Thome, M., and Littman, D. R. (2003) Requirement for CARMA1 in Antigen Receptor-Induced NF-Kappa B Activation and Lymphocyte Proliferation. Curr Biol. 13, 1252-1258.
61. Okada, T., Maeda, A., Iwamatsu, A., Gotoh, K., and Kurosaki, T. (2000) BCAP: The Tyrosine Kinase Substrate that Connects B Cell Receptor to Phosphoinositide 3-Kinase Activation. Immunity. 13, 817-827.
62. Ding, J., Takano, T., Gao, S., Han, W., Noda, C., Yanagi, S., and Yamamura, H. (2000) Syk is Required for the Activation of Akt Survival Pathway in B Cells Exposed to Oxidative Stress. J Biol Chem. 275, 30873-30877.
63. Rao, N., Ghosh, A. K., Ota, S., Zhou, P., Reddi, A. L., Hakezi, K., Druker, B. K., Wu, J., and Band, H. (2001) The Non-Receptor Tyrosine Kinase Syk is a Target of Cbl-Mediated Ubiquitylation upon B-Cell Receptor Stimulation. EMBO J. 20, 7085-7095.
64. Jiang, A., Craxton, A., Kurosaki, T., and Clark, E. A. (1998) Different Protein Tyrosine Kinases are Required for B Cell Antigen Receptor-Mediated Activation of Extracellular Signal-Regulated Kinase, c-Jun NH2-Terminal Kinase 1, and p38 Mitogen-Activated Protein Kinase. J Exp Med. 188, 1297-1306.
67. Baba, Y., Hashimoto, S., Matsushita, M., Watanabe, D., Kishimoto, T., Kurosaki, T., and Tsukada, S. (2001) BLNK Mediates Syk-Dependent Btk Activation. Proc Natl Acad Sci U S A. 98, 2582-2586.
69. Miranti, C. K., Leng, L., Maschberger, P., Brugge, J. S., and Shattil, S. J. (1998) Identification of a Novel Integrin Signaling Pathway Involving the Kinase Syk and the Guanine Nucleotide Exchange Factor Vav1. Curr Biol. 8, 1289-1299.
72. Abtahian, F., Guerriero, A., Sebzda, E., Lu, M. M., Zhou, R., Mocsai, A., Myers, E. E., Huang, B., Jackson, D. G., Ferrari, V. A., Tybulewicz, V., Lowell, C. A., Lepore, J. J., Koretzky, G. A., and Kahn, M. L. (2003) Regulation of Blood and Lymphatic Vascular Separation by Signaling Proteins SLP-76 and Syk. Science. 299, 247-251.
73. Reeve, J. L., Zou, W., Liu, Y., Maltzman, J. S., Ross, F. P., and Teitelbaum, S. L. (2009) SLP-76 Couples Syk to the Osteoclast Cytoskeleton. J Immunol. 183, 1804-1812.
74. Gross, B. S., Lee, J. R., Clements, J. L., Turner, M., Tybulewicz, V. L., Findell, P. R., Koretzky, G. A., and Watson, S. P. (1999) Tyrosine Phosphorylation of SLP-76 is Downstream of Syk Following Stimulation of the Collagen Receptor in Platelets. J Biol Chem. 274, 5963-5971.
76. Ishiai, M., Kurosaki, M., Pappu, R., Okawa, K., Ronko, I., Fu, C., Shibata, M., Iwamatsu, A., Chan, A. C., and Kurosaki, T. (1999) BLNK Required for Coupling Syk to PLC Gamma 2 and Rac1-JNK in B Cells. Immunity. 10, 117-125.
77. Beitz, L. O., Fruman, D. A., Kurosaki, T., Cantley, L. C., and Scharenberg, A. M. (1999) SYK is Upstream of Phosphoinositide 3-Kinase in B Cell Receptor Signaling. J Biol Chem. 274, 32662-32666.
79. Kahner, B. N., Dorsam, R. T., Mada, S. R., Kim, S., Stalker, T. J., Brass, L. F., Daniel, J. L., Kitamura, D., and Kunapuli, S. P. (2007) Hematopoietic Lineage Cell Specific Protein 1 (HS1) is a Functionally Important Signaling Molecule in Platelet Activation. Blood. 110, 2449-2456.
80. Ruzzene, M., Brunati, A. M., Marin, O., Donella-Deana, A., and Pinna, L. A. (1996) SH2 Domains Mediate the Sequential Phosphorylation of HS1 Protein by p72syk and Src-Related Protein Tyrosine Kinases. Biochemistry. 35, 5327-5332.
81. Gross, O., Gewies, A., Finger, K., Schafer, M., Sparwasser, T., Peschel, C., Forster, I., and Ruland, J. (2006) Card9 Controls a Non-TLR Signalling Pathway for Innate Anti-Fungal Immunity. Nature. 442, 651-656.
82. Gross, O., Poeck, H., Bscheider, M., Dostert, C., Hannesschlager, N., Endres, S., Hartmann, G., Tardivel, A., Schweighoffer, E., Tybulewicz, V., Mocsai, A., Tschopp, J., and Ruland, J. (2009) Syk Kinase Signalling Couples to the Nlrp3 Inflammasome for Anti-Fungal Host Defence. Nature. 459, 433-436.
84. Jabril-Cuenod, B., Zhang, C., Scharenberg, A. M., Paolini, R., Numerof, R., Beaven, M. A., and Kinet, J. P. (1996) Syk-Dependent Phosphorylation of Shc. A Potential Link between FcepsilonRI and the Ras/mitogen-Activated Protein Kinase Signaling Pathway through SOS and Grb2. J Biol Chem. 271, 16268-16272.
85. Angibaud, J., Louveau, A., Baudouin, S. J., Nerriere-Daguin, V., Evain, S., Bonnamain, V., Hulin, P., Csaba, Z., Dournaud, P., Thinard, R., Naveilhan, P., Noraz, N., Pellier-Monnin, V., and Boudin, H. (2011) The Immune Molecule CD3zeta and its Downstream Effectors ZAP-70/Syk Mediate Ephrin Signaling in Neurons to Regulate Early Neuritogenesis. J Neurochem. 119, 708-722.
86. Shukla, U., Hatani, T., Nakashima, K., Ogi, K., and Sada, K. (2009) Tyrosine Phosphorylation of 3BP2 Regulates B Cell Receptor-Mediated Activation of NFAT. J Biol Chem. 284, 33719-33728.
87. Chen, G., Dimitriou, I. D., La Rose, J., Ilangumaran, S., Yeh, W. C., Doody, G., Turner, M., Gommerman, J., and Rottapel, R. (2007) The 3BP2 Adapter Protein is Required for Optimal B-Cell Activation and Thymus-Independent Type 2 Humoral Response. Mol Cell Biol. 27, 3109-3122.
88. Han, C., Jin, J., Xu, S., Liu, H., Li, N., and Cao, X. (2010) Integrin CD11b Negatively Regulates TLR-Triggered Inflammatory Responses by Activating Syk and Promoting Degradation of MyD88 and TRIF Via Cbl-b. Nat Immunol. 11, 734-742.
91. Mallick-Wood, C. A., Pao, W., Cheng, A. M., Lewis, J. M., Kulkarni, S., Bolen, J. B., Rowley, B., Tigelaar, R. E., Pawson, T., and Hayday, A. C. (1996) Disruption of Epithelial Gamma Delta T Cell Repertoires by Mutation of the Syk Tyrosine Kinase. Proc Natl Acad Sci U S A. 93, 9704-9709.
92. Brumbaugh, K. M., Binstadt, B. A., Billadeau, D. D., Schoon, R. A., Dick, C. J., Ten, R. M., and Leibson, P. J. (1997) Functional Role for Syk Tyrosine Kinase in Natural Killer Cell-Mediated Natural Cytotoxicity. J Exp Med. 186, 1965-1974.
93. Kiefer, F., Brumell, J., Al-Alawi, N., Latour, S., Cheng, A., Veillette, A., Grinstein, S., and Pawson, T. (1998) The Syk Protein Tyrosine Kinase is Essential for Fcgamma Receptor Signaling in Macrophages and Neutrophils. Mol Cell Biol. 18, 4209-4220.
94. Crowley, M. T., Costello, P. S., Fitzer-Attas, C. J., Turner, M., Meng, F., Lowell, C., Tybulewicz, V. L., and DeFranco, A. L. (1997) A Critical Role for Syk in Signal Transduction and Phagocytosis Mediated by Fcgamma Receptors on Macrophages. J Exp Med. 186, 1027-1039.
96. Xu, S., Huo, J., Gunawan, M., Su, I. H., and Lam, K. P. (2009) Activated Dectin-1 Localizes to Lipid Raft Microdomains for Signaling and Activation of Phagocytosis and Cytokine Production in Dendritic Cells. J Biol Chem. 284, 22005-22011.
98. Finney, B. A., Schweighoffer, E., Navarro-Nunez, L., Benezech, C., Barone, F., Hughes, C. E., Langan, S. A., Lowe, K. L., Pollitt, A. Y., Mourao-Sa, D., Sheardown, S., Nash, G. B., Smithers, N., Reis e Sousa, C., Tybulewicz, V. L., and Watson, S. P. (2012) CLEC-2 and Syk in the megakaryocytic/platelet Lineage are Essential for Development. Blood. 119, 1747-1756.
101. Inui, M., Kikuchi, Y., Aoki, N., Endo, S., Maeda, T., Sugahara-Tobinai, A., Fujimura, S., Nakamura, A., Kumanogoh, A., Colonna, M., and Takai, T. (2009) Signal Adaptor DAP10 Associates with MDL-1 and Triggers Osteoclastogenesis in Cooperation with DAP12. Proc Natl Acad Sci U S A. 106, 4816-4821.
102. Yamasaki, S., Ishikawa, E., Sakuma, M., Hara, H., Ogata, K., and Saito, T. (2008) Mincle is an ITAM-Coupled Activating Receptor that Senses Damaged Cells. Nat Immunol. 9, 1179-1188.
103. Sato, K., Yang, X. L., Yudate, T., Chung, J. S., Wu, J., Luby-Phelps, K., Kimberly, R. P., Underhill, D., Cruz, P. D.,Jr, and Ariizumi, K. (2006) Dectin-2 is a Pattern Recognition Receptor for Fungi that Couples with the Fc Receptor Gamma Chain to Induce Innate Immune Responses. J Biol Chem. 281, 38854-38866.
104. Zou, W., Reeve, J. L., Liu, Y., Teitelbaum, S. L., and Ross, F. P. (2008) DAP12 Couples c-Fms Activation to the Osteoclast Cytoskeleton by Recruitment of Syk. Mol Cell. 31, 422-431.
105. Otero, K., Turnbull, I. R., Poliani, P. L., Vermi, W., Cerutti, E., Aoshi, T., Tassi, I., Takai, T., Stanley, S. L., Miller, M., Shaw, A. S., and Colonna, M. (2009) Macrophage Colony-Stimulating Factor Induces the Proliferation and Survival of Macrophages Via a Pathway Involving DAP12 and Beta-Catenin. Nat Immunol. 10, 734-743.
106. Zou, W., Kitaura, H., Reeve, J., Long, F., Tybulewicz, V. L., Shattil, S. J., Ginsberg, M. H., Ross, F. P., and Teitelbaum, S. L. (2007) Syk, c-Src, the alphavbeta3 Integrin, and ITAM Immunoreceptors, in Concert, Regulate Osteoclastic Bone Resorption. J Cell Biol. 176, 877-888.
107. Mocsai, A., Abram, C. L., Jakus, Z., Hu, Y., Lanier, L. L., and Lowell, C. A. (2006) Integrin Signaling in Neutrophils and Macrophages Uses Adaptors Containing Immunoreceptor Tyrosine-Based Activation Motifs. Nat Immunol. 7, 1326-1333.
108. Hamerman, J. A., Ni, M., Killebrew, J. R., Chu, C. L., and Lowell, C. A. (2009) The Expanding Roles of ITAM Adapters FcRgamma and DAP12 in Myeloid Cells. Immunol Rev. 232, 42-58.
110. Hsieh, C. L., Koike, M., Spusta, S. C., Niemi, E. C., Yenari, M., Nakamura, M. C., and Seaman, W. E. (2009) A Role for TREM2 Ligands in the Phagocytosis of Apoptotic Neuronal Cells by Microglia. J Neurochem. 109, 1144-1156.
111. Mocsai, A., Humphrey, M. B., Van Ziffle, J. A., Hu, Y., Burghardt, A., Spusta, S. C., Majumdar, S., Lanier, L. L., Lowell, C. A., and Nakamura, M. C. (2004) The Immunomodulatory Adapter Proteins DAP12 and Fc Receptor Gamma-Chain (FcRgamma) Regulate Development of Functional Osteoclasts through the Syk Tyrosine Kinase. Proc Natl Acad Sci U S A. 101, 6158-6163.
113. Krishnan, S., Warke, V. G., Nambiar, M. P., Tsokos, G. C., and Farber, D. L. (2003) The FcR Gamma Subunit and Syk Kinase Replace the CD3 Zeta-Chain and ZAP-70 Kinase in the TCR Signaling Complex of Human Effector CD4 T Cells. J Immunol. 170, 4189-4195.
116. Muta, T., Kurosaki, T., Misulovin, Z., Sanchez, M., Nussenzweig, M. C., and Ravetch, J. V. (1994) A 13-Amino-Acid Motif in the Cytoplasmic Domain of Fc Gamma RIIB Modulates B-Cell Receptor Signalling. Nature. 368, 70-73.
117. Mocsai, A., Zhou, M., Meng, F., Tybulewicz, V. L., and Lowell, C. A. (2002) Syk is Required for Integrin Signaling in Neutrophils. Immunity. 16, 547-558.
120. Yousefi, S., Hoessli, D. C., Blaser, K., Mills, G. B., and Simon, H. U. (1996) Requirement of Lyn and Syk Tyrosine Kinases for the Prevention of Apoptosis by Cytokines in Human Eosinophils. J Exp Med. 183, 1407-1414.
121. Costello, P. S., Turner, M., Walters, A. E., Cunningham, C. N., Bauer, P. H., Downward, J., and Tybulewicz, V. L. (1996) Critical Role for the Tyrosine Kinase Syk in Signalling through the High Affinity IgE Receptor of Mast Cells. Oncogene. 13, 2595-2605.
122. Matsubara, S., Li, G., Takeda, K., Loader, J. E., Pine, P., Masuda, E. S., Miyahara, N., Miyahara, S., Lucas, J. J., Dakhama, A., and Gelfand, E. W. (2006) Inhibition of Spleen Tyrosine Kinase Prevents Mast Cell Activation and Airway Hyperresponsiveness. Am J Respir Crit Care Med. 173, 56-63.
123. Sedlik, C., Orbach, D., Veron, P., Schweighoffer, E., Colucci, F., Gamberale, R., Ioan-Facsinay, A., Verbeek, S., Ricciardi-Castagnoli, P., Bonnerot, C., Tybulewicz, V. L., Di Santo, J., and Amigorena, S. (2003) A Critical Role for Syk Protein Tyrosine Kinase in Fc Receptor-Mediated Antigen Presentation and Induction of Dendritic Cell Maturation. J Immunol. 170, 846-852.
124. Poole, A., Gibbins, J. M., Turner, M., van Vugt, M. J., van de Winkel, J. G., Saito, T., Tybulewicz, V. L., and Watson, S. P. (1997) The Fc Receptor Gamma-Chain and the Tyrosine Kinase Syk are Essential for Activation of Mouse Platelets by Collagen. EMBO J. 16, 2333-2341.
125. Suzuki-Inoue, K., Fuller, G. L., Garcia, A., Eble, J. A., Pohlmann, S., Inoue, O., Gartner, T. K., Hughan, S. C., Pearce, A. C., Laing, G. D., Theakston, R. D., Schweighoffer, E., Zitzmann, N., Morita, T., Tybulewicz, V. L., Ozaki, Y., and Watson, S. P. (2006) A Novel Syk-Dependent Mechanism of Platelet Activation by the C-Type Lectin Receptor CLEC-2. Blood. 107, 542-549.
126. Obergfell, A., Eto, K., Mocsai, A., Buensuceso, C., Moores, S. L., Brugge, J. S., Lowell, C. A., and Shattil, S. J. (2002) Coordinate Interactions of Csk, Src, and Syk Kinases with [Alpha]IIb[Beta]3 Initiate Integrin Signaling to the Cytoskeleton. J Cell Biol. 157, 265-275.
127. Yamada, T., Fujieda, S., Yanagi, S., Yamamura, H., Inatome, R., Sunaga, H., and Saito, H. (2001) Protein-Tyrosine Kinase Syk Expressed in Human Nasal Fibroblasts and its Effect on RANTES Production. J Immunol. 166, 538-543.
128. Cha, H. S., Boyle, D. L., Inoue, T., Schoot, R., Tak, P. P., Pine, P., and Firestein, G. S. (2006) A Novel Spleen Tyrosine Kinase Inhibitor Blocks c-Jun N-Terminal Kinase-Mediated Gene Expression in Synoviocytes. J Pharmacol Exp Ther. 317, 571-578.
129. Ulanova, M., Puttagunta, L., Marcet-Palacios, M., Duszyk, M., Steinhoff, U., Duta, F., Kim, M. K., Indik, Z. K., Schreiber, A. D., and Befus, A. D. (2005) Syk Tyrosine Kinase Participates in beta1-Integrin Signaling and Inflammatory Responses in Airway Epithelial Cells. Am J Physiol Lung Cell Mol Physiol. 288, L497-507.
130. Tsuchida, S., Yanagi, S., Inatome, R., Ding, J., Hermann, P., Tsujimura, T., Matsui, N., and Yamamura, H. (2000) Purification of a 72-kDa Protein-Tyrosine Kinase from Rat Liver and its Identification as Syk: Involvement of Syk in Signaling Events of Hepatocytes. J Biochem. 127, 321-327.
132. Hoeller, C., Thallinger, C., Pratscher, B., Bister, M. D., Schicher, N., Loewe, R., Heere-Ress, E., Roka, F., Sexl, V., and Pehamberger, H. (2005) The Non-Receptor-Associated Tyrosine Kinase Syk is a Regulator of Metastatic Behavior in Human Melanoma Cells. J Invest Dermatol. 124, 1293-1299.
134. Tsujimura, T., Yanagi, S., Inatome, R., Takano, T., Ishihara, I., Mitsui, N., Takahashi, S., and Yamamura, H. (2001) Syk Protein-Tyrosine Kinase is Involved in Neuron-Like Differentiation of Embryonal Carcinoma P19 Cells. FEBS Lett. 489, 129-133.
135. Toyama, T., Iwase, H., Yamashita, H., Hara, Y., Omoto, Y., Sugiura, H., Zhang, Z., and Fujii, Y. (2003) Reduced Expression of the Syk Gene is Correlated with Poor Prognosis in Human Breast Cancer. Cancer Lett. 189, 97-102.
137. Baudot, A. D., Jeandel, P. Y., Mouska, X., Maurer, U., Tartare-Deckert, S., Raynaud, S. D., Cassuto, J. P., Ticchioni, M., and Deckert, M. (2009) The Tyrosine Kinase Syk Regulates the Survival of Chronic Lymphocytic Leukemia B Cells through PKCdelta and Proteasome-Dependent Regulation of Mcl-1 Expression. Oncogene. 28, 3261-3273.
141. Bohmer, R., Neuhaus, B., Buhren, S., Zhang, D., Stehling, M., Bock, B., and Kiefer, F. (2010) Regulation of Developmental Lymphangiogenesis by Syk(+) Leukocytes. Dev Cell. 18, 437-449.
143. Sancho, D., Joffre, O. P., Keller, A. M., Rogers, N. C., Martinez, D., Hernanz-Falcon, P., Rosewell, I., and Reis e Sousa, C. (2009) Identification of a Dendritic Cell Receptor that Couples Sensing of Necrosis to Immunity. Nature. 458, 899-903.
144. Siegel, R., Kim, U., Patke, A., Yu, X., Ren, X., Tarakhovsky, A., and Roeder, R. G. (2006) Nontranscriptional Regulation of SYK by the Coactivator OCA-B is Required at Multiple Stages of B Cell Development. Cell. 125, 761-774.
146. Avdi, N. J., Nick, J. A., Whitlock, B. B., Billstrom, M. A., Henson, P. M., Johnson, G. L., and Worthen, G. S. (2001) Tumor Necrosis Factor-Alpha Activation of the c-Jun N-Terminal Kinase Pathway in Human Neutrophils. Integrin Involvement in a Pathway Leading from Cytoplasmic Tyrosine Kinases Apoptosis. J Biol Chem. 276, 2189-2199.
149. Wang, L., Gordon, R. A., Huynh, L., Su, X., Park Min, K. H., Han, J., Arthur, J. S., Kalliolias, G. D., and Ivashkiv, L. B. (2010) Indirect Inhibition of Toll-Like Receptor and Type I Interferon Responses by ITAM-Coupled Receptors and Integrins. Immunity. 32, 518-530.
150. Sanjuan, M. A., Rao, N., Lai, K. T., Gu, Y., Sun, S., Fuchs, A., Fung-Leung, W. P., Colonna, M., and Karlsson, L. (2006) CpG-Induced Tyrosine Phosphorylation Occurs Via a TLR9-Independent Mechanism and is Required for Cytokine Secretion. J Cell Biol. 172, 1057-1068.
151. Ulanova, M., Asfaha, S., Stenton, G., Lint, A., Gilbertson, D., Schreiber, A., and Befus, D. (2007) Involvement of Syk Protein Tyrosine Kinase in LPS-Induced Responses in Macrophages. J Endotoxin Res. 13, 117-125.
152. Djoko, B., Chiou, R. Y., Shee, J. J., and Liu, Y. W. (2007) Characterization of Immunological Activities of Peanut Stilbenoids, Arachidin-1, Piceatannol, and Resveratrol on Lipopolysaccharide-Induced Inflammation of RAW 264.7 Macrophages. J Agric Food Chem. 55, 2376-2383.
|
Science Writers | Eva Marie Y. Moresco, Anne Murray |
Illustrators | Peter Jurek |
Authors | Ying Wang, Hexin Shi, Ming Zeng, Bruce Beutler |