Phenotypic Mutation 'Orange'

• Allele: Orange
• Mutation Type: critical splice donor site (1 bp from exon)
• Chromosome: 1
• Coordinate: 87,697,546 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Inpp5d
• Gene Name: inositol polyphosphate-5-phosphatase D
• Synonym(s): s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
• Chromosomal Location: 87,620,312-87,720,507 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014] ; PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000044647 ^†] [ENSMUSP00000072763 ^†] [ENSMUSP00000126569 ^†] [ENSMUSP00000131244 ^†] [ENSMUSP00000127941 ^†] [ENSMUSP00000132384 ^†] † probably from a misspliced transcript
• AlphaFold: Q9ES52
• SMART Domains: Protein: ENSMUSP00000044647; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000072763; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000126569; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000126569; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000131244; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000131244; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000127941; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000132384; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000132384; Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9589
• Is this an essential gene?: Probably essential (E-score: 0.889)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice
• Last Updated: 2020-06-05 4:38 PM by Thomas Gallagher
• Record Created: 2013-02-07 11:47 PM by Ming Zeng
• Record Posted: 2014-12-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Ming Zeng, Kuan-Wen Wang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010566; NM_001110192, NM_001110193; MGI: 107357

Alleles Listed at MGI

All alleles(62) : Targeted(7) Gene trapped(53) Chemically induced(2)

Repository

MMRRC:37623

Phenotypic Description

Figure 1. Orange mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Orange mice exhibit a decreased percentage of peripheral IgD + B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Orange mice exhibit decreased frequencies of peripheral IgM + B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The orange phenotype was initially identified among G3 mice of the pedigree R0010, some of which showed a decrease in the frequency of B cells (Figure 1) including IgD⁺ (Figure 2) and IgM⁺ B cells (Figure 3), all in the peripheral blood.

Nature of Mutation

See entry for Inpp5d allele Salamander. 

Figure 4. Linkage mapping of reduced B cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R0010. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction , respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Inpp5d: G to A transition at base pair 87697546 (v38) on chromosome 1, or base pair or 77,235 in the GenBank genomic region, NC_000067 encoding Inpp5d. The strongest association was found with a recessive model of linkage to the reduced B cell frequency, wherein 6 affected variant homozygotes departed phenotypically from 14 homozygous reference mice and 13 heterozygous mice with a P value of 2.3737 x 10^-6 (Figure 4). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

Figure 5. RT-PCR analysis of Inpp5d in blood from the orange mice. (A) Inpp5d cDNA and primer binding sites used in RT-PCR and sequencing . The forward primer was designed upstream of the orange mutation in exon 10 and the reverse primer downstream of the orange mutation within exon 14. The forward sequencing primer is in exon 10. (B) RT-PCR results using the primers shown in (A).

RT-PCR and sequencing analysis were used to examine Inpp5d splicing in orange tissues. Using primers spanning exons 10-14 (5’-CTAAACAAGTTGGTGATTTTGGTGG-3’; 5’-CATTGAACATGAAGGACACTCCCA-3’) (Figure 5A), RT-PCR of blood mRNA showed two Inpp5d PCR amplicons in the homozygous orange mouse compared to the wild-type mouse (Figure 5B). Sequence analysis determined that the cDNA amplified from orange blood contained a 197-base pair deletion corresponding to exon 12 (out of 27 total exons) in the cDNA transcript ENSMUST00000169754, indicating that the orange mutation abolishes the function of the intron 12 donor splice site. Aberrant splicing results in skipping of exon 12  and the out of frame deletion of the 65 amino acids (amino acids 418-482) encoded by exon 12, resulting in coding of a premature stop codon within exon 13 (amino acid 436 in the wild-type protein).  

 

<--exon 11  <--exon 12 intron 12-->   exon 13--> 1324  AAAAGAGAA…AACATGG……ATTTAAAACA GTGAGCAGCT……………AGAGCATGAGAATCG 1688 383   -K--R--E-…-N--M--……--F--K--T-                -R--A--*        436           CORRECT         DELETED                  ABERRANT

 

The donor splice site of intron 12, which is destroyed by the orange mutation, is indicated in blue lettering; the mutated nucleotide is indicated in red lettering.

Protein Prediction

Figure 6. Domain structure of SHIP protein isoforms. SHIPβ and SHIPδ arise from alternative splicing that occurs adjacent to the first NPXY motif. SHIPβ arises from in-frame splicing, while SHIPδ arises from out-of-frame splicing that results in an alternative C-terminal domain. The sSHIP isoform has an alternative promoter. The SH2 containing isoforms have been shown to be expressed in differentiated hematopoietic cells, mouse embyronic fibroblasts (MEF) and vascular endothelial cells. The sSHIP isoform is expressed by embryonic stem (ES) cells and HSC. Full-length SHIP is also expressed in HSC. Other potential isoforms have been described (not shown). The orange mutation alters the donor splice site of intron 12 and is proposed to destroy the reading frame in the middle of the encoded SHIP-1 polypeptide chain (aberrant amino acids after position 416), and subsequently creating a premature stop codon that would truncate the protein after amino acid 436. The pink box indicates the portion of the SHIP-1 protein encoded by exon 12. The image is interactive. Other Inpp5d mutations are noted in red. Click on each allele for more information.

Inpp5d encodes SHIP-1, an 1191-amino acid Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase (Figure 6). Two of SHIP-1 isoforms (SHIPβ and SHIPδ) have C-terminal alterations that remove potential SH3-domain binding regions and disrupt a potential binding site for the p85 subunit of phosphatidylinositol 3-kinase (PI3K). One of the SHIP isoforms (sSHIP) does not utilize the intron 5 donor splice site.  Instead, this sequence uses an alternative promoter found in intron 5 to add an extra nine amino acids to the protein sequence coded by exons 6-27.  Thus, this isoform is missing the N-terminal SH2 domain and the amino acid sequence deleted by the styx mutation, but is able to interact with Grb2.  Aberrant splicing of the Inpp5d transcript due to the orange mutation would result in a truncated protein that would not contain the inositol polyphosphate 5-phosphatase motifs, two NPXY motifs, and the C-terminal proline-rich domain with several SH3 binding motifs (Figure 6). The orange mutation would affect all of the SHIP isoforms.

 

Please see the record styx Salamander for information about Inpp5d.

Putative Mechanism

In hematolymphoid cells, SHIP can be recruited to a wide variety of receptor complexes including growth factor receptors and immune receptors. SHIP is recruited to receptor-associated signaling complexes via adaptors (e.g. Shc, Grb2, Dok3), scaffold proteins like Gab1 or directly via its SH2 domain. After recruitment to the plasma membrane, SHIP can then hydrolyze PIP₃. Hydrolysis of PIP₃ inhibits recruitment of PH domain containing kinases like Akt, Btk (Bruton’s tyrosine kinase), and phospholipase C (PLC)-γ to the plasma membrane and thus limits the activity of several different PI3K effectors that promote cell survival, migration, differentiation or proliferation. These include distal kinases like MAP/ERK, JNK/SAPK, p38 MAPK and key transcription factors such as NF-κB and NFAT.

 

The orange mice exhibit reduced levels of B cells similar to Inpp5d knockout mice [MGI:2386884; (1;2)] and myeloid-specific conditional knockout mice [MGI:3715983; (3)]. The changes in B cell number was attributed to high levels of the cytokine interleukin-6 (IL-6), which directly contributes to the reduced level of B cells seen in these mice as IL-6 is known to inhibit B cell development while enhancing myeloid cell development (1). In addition to the expansion of other myeloid cell types, SHIP-deficient animals carry large numbers of myeloid suppressor cells that are potent antagonists of allogeneic T cell activation by host APCs in vitro (4). In addition, SHIP-deficient T cells do not produce a type 2 T helper (Th2) response, which is important in determining B cell antibody class switching, when exposed to the proper stimuli (5). An ENU-induced model with a mutation in Inpp5d [Iso651Thr; MGI:5050823; (6)] exhibited decreased levels of double-positive thymocytes and a reduced number of circulating lymphocytes. This study determined that a SHIP1 isoform expressed in stem and progenitor cells (s-SHIP), and lost upon the ENU-induced mutation, is necessary for SHIP1 function in hematopoiesis (6).

Primers

PCR Primer
Orange_pcr_F: TTGCTGTTGAAGGTAATGCACCCC
Orange_pcr_R: TTTGGAACCCTGAACATGCACCCC

Genotyping

Orange genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

PCR Primers

Orange(F): 5’- TTGCTGTTGAAGGTAATGCACCCC-3’

Orange(R): 5’- TTTGGAACCCTGAACATGCACCCC-3’

 
Sequencing Primer

Orange_seq(F): 5’- CAAGAAGATCACGTCCTGGTTTC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 726 nucleotides (from Genbank genomic region NC_000067 for linear DNA sequence of Inpp5d) is amplified:

 

77026                                                  ttgct gttgaaggta    

77041 atgcaccccc tcccaagaag atcacgtcct ggtttctctc caaggggcag ggaaagacac    

77101 gggacgactc tgctgactac atcccccatg acatctatgt gattggcacc caggaggatc    

77161 cccttggaga gaaggagtgg ctggagctac tcaggcactc cctgcaagaa gtcaccagca    

77221 tgacatttaa aacagtgagc agctggccag gcctggggtg ggaagacagc agactctttc    

77281 aagcattcca gaagtcagac aggatacttc caaagatgta taggattgct caggggtacc    

77341 ccactttcag agccacagat gtgcattgag gtggcaccct tacaagttga tagggtcctg    

77401 agtccgccat cttccctact cctgcttaaa agaataatat cgccgggcgt ggtggtgcac    

77461 gcctttaatc ccagcactcg ggaggcagag gcaggcggat ttctgagttt gaggccagcc    

77521 tggtctacaa agtgaattcc agggcagcca gggctataca gagaaaaaac caaaaagaaa    

77581 agaaaaagaa taatatttac ttcctagatg cattttcagt cccagttctc atctctgagg    

77641 tgctttgtct catttctagg cattgttgga agttccccct gaaagctagg aaatacagac    

77701 agggtgtctt actcccaggg tggaaccggg gtgcatgttc agggttccaa a

 

Primer binding sites are underlined; the mutated T is shown in red text.

References

  1. Nakamura, K., Kouro, T., Kincade, P. W., Malykhin, A., Maeda, K., and Coggeshall, K. M. (2004) Src Homology 2-Containing 5-Inositol Phosphatase (SHIP) Suppresses an Early Stage of Lymphoid Cell Development through Elevated Interleukin-6 Production by Myeloid Cells in Bone Marrow. J Exp Med. 199, 243-254.

  2. Maeda, K., Baba, Y., Nagai, Y., Miyazaki, K., Malykhin, A., Nakamura, K., Kincade, P. W., Sakaguchi, N., and Coggeshall, K. M. (2005) IL-6 Blocks a Discrete Early Step in Lymphopoiesis. Blood. 106, 879-885.

  3. Karlsson, M. C., Guinamard, R., Bolland, S., Sankala, M., Steinman, R. M., and Ravetch, J. V. (2003) Macrophages Control the Retention and Trafficking of B Lymphocytes in the Splenic Marginal Zone. J Exp Med. 198, 333-340.

  4. Ghansah, T., Paraiso, K. H., Highfill, S., Desponts, C., May, S., McIntosh, J. K., Wang, J. W., Ninos, J., Brayer, J., Cheng, F., Sotomayor, E., and Kerr, W. G. (2004) Expansion of Myeloid Suppressor Cells in SHIP-Deficient Mice Represses Allogeneic T Cell Responses. J Immunol. 173, 7324-7330.

  5. Tarasenko, T., Kole, H. K., Chi, A. W., Mentink-Kane, M. M., Wynn, T. A., and Bolland, S. (2007) T Cell-Specific Deletion of the Inositol Phosphatase SHIP Reveals its Role in Regulating Th1/Th2 and Cytotoxic Responses. Proc Natl Acad Sci U S A. 104, 11382-11387.

  6. Nguyen, N. Y., Maxwell, M. J., Ooms, L. M., Davies, E. M., Hilton, A. A., Collinge, J. E., Hilton, D. J., Kile, B. T., Mitchell, C. A., Hibbs, M. L., Jane, S. M., and Curtis, D. J. (2011) An ENU-Induced Mouse Mutant of SHIP1 Reveals a Critical Role of the Stem Cell Isoform for Suppression of Macrophage Activation. Blood. 117, 5362-5371.