Phenotypic Mutation 'Lemon'

• Allele: Lemon
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 3,746,768 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Lyn
• Gene Name: LYN proto-oncogene, Src family tyrosine kinase
• Synonym(s): Hck-2
• Chromosomal Location: 3,678,115-3,813,122 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Histidine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000038838] [ENSMUSP00000100075]
• AlphaFold: P25911
• PDB Structure: Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION] ; Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION] ; Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION] ; Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION] ; Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000038838; Gene: ENSMUSG00000042228; AA Change: H182R

Domain	Start	End	E-Value	Type
SH3	66	122	9.24e-21	SMART
SH2	127	217	5.38e-33	SMART
TyrKc	247	497	3.25e-137	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000041377)
• SMART Domains: Protein: ENSMUSP00000100075; Gene: ENSMUSG00000042228; AA Change: H161R

Domain	Start	End	E-Value	Type
SH3	45	101	5.8e-23	SMART
SH2	106	196	3.3e-35	SMART
TyrKc	226	476	1.6e-139	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000103010)
• Meta Mutation Damage Score: 0.9665
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice
• MMRRC Submission: 037578-MU
• Last Updated: 2019-02-06 11:39 AM by Diantha La Vine
• Record Created: 2013-02-11 7:33 PM by Ming Zeng
• Record Posted: 2014-10-30
• Science Writers: Anne Murray
• Illustrators: Peter Jurek, Katherine Timer
• Authors: Ming Zeng, Kuan-wen Wang, Jin Huk Choi, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001111096, NM_010747; MGI:96892

Alleles Listed at MGI

All alleles(11) : Chemically induced (ENU)(3) Targeted(8)

Phenotypic Description

Figure 1. Lemon mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lemon mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lemon mice exhibit decreased percentages of peripheral IgD + B cells. Flow cytometric analysis of peripheral blood was utilized to determine the percentage of I gD + B cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Lemon mice exhibit decreased percentages of peripheral IgM + B cells. Flow cytometric analysis of peripheral blood was utilized to determine the percentage of I gM + B cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lemon phenotype was identified among G3 mice of the pedigree R0079, some of which showed an increased frequency of neutrophils (Figure 1) and a reduced frequency of B cells (Figure 2) including a reduced percentage of IgD⁺ (Figure 3) and IgM⁺ B cells (Figure 4), all in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the reduced B cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R0079. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction , respectively.

Whole exome sequencing of the G1 grandsire (R0079) identified 63 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lyn: an A to G transition at base pair 3,746,768 (v38) on chromosome 4, or base pair 68,648 in the GenBank genomic region NC_000070. The strongest association was found with an additive (semi-dominant) model of linkage to the reduced frequency of B cells, wherein 10 affected variant homozygotes and 22 heterozygous mice departed phenotypically from 14 homozygous reference mice with a P value of 1.048 x 10^-6 (Figure 5). A  semidominant effect was observed in most of the assays; in no assay was a purely dominant effect observed. The mutation corresponds to residue 794 in the mRNA sequence NM_001111096 within exon 7 of 13 total exons as well as to residue 731 in the mRNA sequence NM_010747 within exon 7 of 13 total exons.

 

68632 GGTGATGTCATTAAGCACTACAAAATTAGAAGT

177   -G--D--V--I--K--H--Y--K--I--R--S- (ENSMUSP00000038838)

156   -G--D--V--I--K--H--Y--K--I--R--S- (ENSMUSP00000100075)

 

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red. Alternative splicing of exon 2 of Lyn produces two Lyn isoforms, Lyn^p56 and Lyn^p53, that differ at the N-terminus (1;2); Lyn^p56 contains an additional 21 amino acids compared to Lyn^p53 [(1); reviewed in (3)]. The mutation results in a histidine (H) to arginine (R) substitution at position 182 (H182R) in the Lyn^p56 (ENSMUSP00000038838) isoform as well as a H to R substitution at position 162 (H162R) in the Lyn^p53 (ENSMUSP00000100075) isoform. The mutation is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.000).

Protein Prediction

Figure 6. Domain structure of Lyn. Please see the text for details about the domains. The Lemon mutation results in a histidine to arginine substitution at position 182. This image is interactive. Other mutations found in the protein are noted in red. Click on each mutation for more information.

Lyn is a member of the Src family of tyrosine kinases (SFKs), which also includes Src, Yes, Fgr, Fyn, Lck (see the record for iconoclast), Hck, Blk, and Yrk. The members of the SFKs share highly conserved domains including a Src-homology 3 (SH3) domain (amino acids 66-122 in Lyn), an SH2 domain (amino acids 127-217), a tyrosine kinase domain (amino acids 247-497), and a C-terminal regulatory region [Figure 6; reviewed in (4-6)]. A ‘unique’ domain of 50-70 amino acids between the N-terminus and the SH3 domain varies among the members of the SFKs (6). The function of the unique domain in Lyn is unknown; in Lck it mediates protein-protein interactions between Lck and the cytoplasmic tails of the T-cell coreceptors CD4 and CD8 (7;8). The unique domain of Lyn undergoes myristoylation at Gly2 after removal of the N-terminal methionine as well as palmitoylation at Cys3 [reviewed in (3;4)]. Myristoylation and palmitoylation of Lyn are essential for anchoring Lyn to the plasma membrane and for its localization into lipid rafts, respectively [(9); reviewed in (3;4)].

 

The SH3 and SH2 domains of Lyn mediate protein-protein interactions between Lyn and Pro-rich motifs and with phosphotyrosine-containing proteins, respectively [(10); reviewed in (3)]. The SH3 domain consists of five anti-parallel β-strands that fold into two anti-parallel β-sheets that are packed at almost right angles to form a β-barrel (11). The β-strands are connected by three loops and by a helical turn connecting strands 4 and 5 (11). A hydrophobic core is formed by the non-polar amino acids (i.e., Val13, Ala15, Leu27, Phe29, Met35, Val37, Ala47, Gly56, Iso58, Pro59, and Val63) of the β-strands and one of the loops that connects the β-strands (11).

 

The kinase domain has N- and C-terminal lobes that flank an ATP- and substrate- binding cleft [Figure 7; PDB:2SRC; (12-15); reviewed in (3)]. The N-terminal lobe is involved in anchoring and orienting ATP, while the C-terminal lobe is primarily responsible for substrate binding and initiating phosphotransfer (16). The N-terminal lobe of mouse Lyn is comprised of a 5-stranded anti-parallel twisted β-sheet and a single large α-helix, termed the αC helix (17). The two most N-terminal β-strands in the N-terminal lobe form a flexible β-strand-turn-β-strand glycine-rich structure called the G-loop (alternatively, the ATP phosphate-binding P-loop) that extends from the N-lobe (16). The side chains of Lys252 and Glu260 within the G-loop form a salt bridge that stabilizes the G-loop in active SFKs and anchors non-transferable ATP α/β-phosphates to allow for the optimal ATP orientation for γ-phosphoryl transfer (12;14;16;18-20). Mutation of residues Lys252 or Glu260 to glycines reduces the catalytic activity of Lyn (16). The C-terminal lobe of the kinase domain is comprised predominantly of α-helices and also contains a 2-stranded anti-parallel β-sheet (17). The two lobes are connected by a loop that borders the cleft that forms the ATP-binding pocket; the loop forms a hinge that makes the overall structure flexible (17).

 

Figure 7. Crystal structure of inactive Src. The unique domain is not part of the structure. UCSF Chimera structure is based on PDB: 2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

Src family kinases are held in a closed, inactive conformation by intramolecular interactions between a phosphorylated tyrosine in the C-terminal tail (Y508 in Lyn) and the SH2 domain [Figure 7; (13;15;17;21;22); reviewed in (3)]. This interaction couples the SH2 domain to the C-terminal tail, and also holds the SH2 and SH3 domains in a rigid conformation that disfavors kinase activation (23). In addition to the SH2-C-terminal tail interaction, the closed conformation of Src family kinases is also maintained by the docking of the SH3 domain onto an internal polyproline type II helical sequence formed by the linker between the SH2 and kinase domains (13;15;21). This polyproline helix is sandwiched between the SH3 domain and the back surface of the N-terminal lobe of the catalytic domain. Binding of the SH2 domain to the phosphorylated tail segment has been proposed to be important for correctly positioning the SH2-kinase domain linker for interaction with the SH3 domain. When the activation loop tyrosine (Tyr397 in Lyn) is dephosphorylated, the αC helix rotates outward, assuming a conformation unable to coordinate the α- and β-phosphates of ATP within the catalytic cleft. Dephosphorylation of Tyr508 by the tyrosine phosphatase CD45 results in a conformation change in Lyn, subsequently promoting Lyn autophosphorylation of Tyr397 and an increase in kinase activity [(24;25); reviewed in (3)]. Phosphorylation of the activation loop also increases the accessibility of the SH3 domain for ligands, and it has been proposed that Src activity may generally control the availability of its regulatory domains [(17;26); reviewed in (3)]. Together, phosphorylation of the tyrosine in the C-terminal tail and dephosphorylation of the activation loop tyrosine promote a closed, inactive conformation in which the lobes of the kinase domain are closely apposed and the αC helix is shifted outwards.

 

The Lemon mutation (His182Arg) is within the SH2 domain of both Lyn isoforms.

Expression/Localization

Lyn is expressed in all blood cells (except T lymphocytes) as well as in the brain, prostate cells, and colon cells [(1;2;27;28); reviewed in (29)]. Within the brain, Lyn is highly expressed in the telencephalon, cerebellum striatum, cortex, and thalamus (28;30;31).

Background

Figure 8. Dual role of Lyn in the regulation of signaling pathways in myeloid cells. Lyn negatively regulates signaling pathways by phosphorylating ITIM-containing receptors (e.g., PIR-B, CD22, and SIRPα) that recruit inhibitory phosphatases (e.g., SHP1/2 or SHIP-1) that downmodulate Jak kinase responses. Lyn can also negatively modulate signaling responses in myeloid cells through the phosphorylation of DOK cytoplasmic proteins that recruit the Ras GTPase-activating protein (rasGAP) and SHIP-1. Lyn can also phosphorylate ITAM domains in immunoreceptors, cytokine receptors, and chemokine receptors to positively modulate signaling. ITAM phosphorylation recruits Syk and mediates downstream signaling events.

The SFKs interact with immune cell receptors, growth factor receptors, integrins, and G protein-coupled receptors to regulate cell migration, adhesion, phagocytosis, cell survival, differentiation, DNA synthesis, and proliferation through the phosphorylation of signaling intermediates [(32); reviewed in (29;33)]. Lyn can act as both a positive and negative signaling molecule in several cell types including hematopoietic progenitors, mature myeloid cells (neutrophils, macrophages, monocytes, eosinophils, and dendritic cells), platelets, erythrocytes, and osteoclasts. Lyn can phosphorylate either immunoreceptor tyrosine-based activation motifs (ITAMs) or immunoreceptor tyrosine-based inhibitory motifs (ITIMs) within the cytoplasmic domains of several receptors including the B-cell receptor (BCR), the high-affinity IgE receptor (FcεRI), CD40 (see the record for walla), the mast/stem cell growth factor receptor (c-KIT; see the record for Pretty2), the thrombopoietin receptor (c-Mpl), the erythropoietin receptor (EpoR), and the high-affinity IgG receptor (FcγRI) [Figure 8; (34-39); reviewed in (3;29)]. Lyn also phosphorylates several signaling substrates including PI3-kinase (PI3K; see the record for stinger), phospholipase C gamma 2 (PLCγ2; see the record for queen), and signal transducer and activator of transcription 5 (STAT5) (17). As a result, Lyn regulates several cellular functions including proliferation, degranulation, cytokine production, adhesion, activation, migration, and survival. A summary of Lyn functions in hematopoietic cells is highlighted in Table 1. Several of these functions are described in more detail, below.

 

Table 1. Summary of Lyn functions in hematopoietic cells. Figure adapted from (29)

	Receptor	Ligand	Cell type	Function	References
Negative role	Type I cytokine receptors	GM-CSF, G-CSF, IL-3, IL-6, IL-4, RANKL, thrombopoietin	Myeloid precursors, macrophages, dendritic cells, mast cells, megakaryocytes	Proliferation, survival, differentiation	(35;40-42)
	Immunoglobulin superfamily receptors	M-CSF, SCF	Myeloid precursors, macrophages, mast cells	Proliferation	(41-43)
	FcεRI	IgE	Mast cells	Proliferation, degranulation, cytokine production	(36;44-46)
	Integrin	Extracellular matrix proteins, counter receptors	Macrophages, neutrophils, myeloid precursors	Adhesion, activation, survival	(47-49)
Positive role	Type I cytokine receptors	IL-5, G-CSF, GM-CSF, Epo	Neutrophils, eosinophils, erythroblasts	Survival, proliferation, differentiation	(41;42;50;51)
	G protein-coupled receptors	Chemokines	Neutrophils, macrophages, myeloid precursors, mast cells	Activation, migration

Abbreviations: G-CSF, granulocyte colony-stimulating factor; SCF, stem cell factor; GM-CSF, granuolocyte-macrophage-colony-stimulating factor; M-CSF, macrophage-colony-stimulating factor; Epo, erythropoietin; RANKL, receptor activator of NF-kappaB ligand

 

Figure 9. Pre-BCR and BCR signaling. Following BCR ligation, Lyn phosphorylates the ITAMs of the Igα/Igβ BCR subunits. These phosphotyrosines then act as docking sites for the SH2 domains of Syk. In pre-BCR signaling, Syk phosphorylates many substrates and triggers signaling pathways that are involved in both proliferation and differentiation of pre-B cells. Syk-mediated signaling downstream from the BCR regulates cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies.

Hematopoietic cells

-B cells

Following BCR ligation, Lyn phosphorylates the ITAMs of the Igα/Igβ BCR subunits [Figure 8 & 9; (52-54)]. These phosphotyrosines then act as docking sites for the SH2 domains of Syk (see the record for poppy), resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including B cell linker (BLNK; see the record for busy), PLCγ2, and protein kinase C β (PKCβ; see the record for Untied). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of PIP₃, which binds selectively to the pleckstrin homology domain of Btk (Bruton’s tyrosine kinase), facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLCγ2, which results in the additional phosphorylation and activation of PLCγ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP₂) to inositol-1,4,5-trisphosphate (IP₃) and diacylglycerol (DAG) (55). The recruitment of Vav1, Nck, and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed in (56)]. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for finlay, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (57)]. Lyn is essential for the terminal differentiation of peripheral B cells as well as the elimination of autoreactive B cells (58); however, Lyn, Fyn, and Blk have redundant functions in pre-B cell expansion and BCR signaling initiation.  

 

Lyn has a non-redundant role in negative regulation of BCR signaling (52). Lyn phosphorylates the ITIMs of the BCR associated co-receptors CD22 (see the record for well), Fc receptor gamma IIb (FcγRIIb), and paired immunoglobulin-like receptor-B (PIR-B) (34;59-63).  Inhibitory signaling involves the activation of the protein tyrosine phosphatase SHP-1 (see the record for spin), and SH2-containing 5’-inositol phosphatase (SHIP-1; see the record for styx) (16). SHIP-1 is recruited to receptor-associated signaling complexes via adaptors (e.g., Shc, Grb2, Dok3), scaffold proteins like Gab1, or directly via its SH2 domain. After recruitment to the plasma membrane, SHIP can then hydrolyze PIP₃. Hydrolysis of PIP₃ inhibits recruitment of PH domain containing kinases like Akt, Btk, and PLCγ to the plasma membrane and thus limits the activity of several different PI3K effectors that promote cell survival, migration, differentiation, or proliferation.

 

-Neutrophils

Lyn phosphorylates ITAMs in the cytoplasmic tail of cytokine receptors (e.g., G-CSFR, GM-CSFR, and M-CSFR) (42). Cytokine receptors are associated with a tethered Jak kinase that phosphorylates tyrosine residues in the receptor cytoplasmic domain upon cytokine binding to the receptor [reviewed in (64)]. Jak-mediated phosphorylation of the receptor provides a docking site for members of the STAT family of transcription factors (e.g., STAT5, STAT3, and STAT1; see the record for domino for information on STAT1). The STAT proteins subsequently dimerize and translocate to the nucleus to regulate gene expression. Lyn is essential for regulation of neutrophil granulopoiesis, apoptosis, and adhesion. Lyn has a positive role in the regulation of calcium influx, MAPK activation and actin polymerization in response to cytokines [reviewed in (29)]. GM-CSF-mediated inhibition of neutrophil apoptosis and the regulation of the pro-survival effect of LPS are dependent on Lyn (42;65). Lyn phosphorylates caspase-8 during resting conditions as well as after LPS stimulation, making it resistant to activation cleavage and subsequently inhibiting the progression of apoptosis (65). Other studies have shown that Lyn is an activator of accelerated apoptosis (66). Lyn recruits SHIP-1 to the plasma membrane, which then blocks pro-survival integrin-induced Akt activation by reducing PIP₃ levels. The role of Lyn in G-CSF-induced signaling is unclear. While some studies have proposed that Lyn is negative regulator of G-CSF signaling, others have shown that Lyn is a positive transducer of G-CSF responses [reviewed in (29)]. Scapini et al. proposed that Lyn may act as a negative regulator of G-CSF responses in neutrophil precursors and may act as a positive regulator in more differentiated cells [reviewed in (29)]. Lyn is also a negative regulator of integrin-dependent responses in neutrophils (47-49). 

 

-Macrophages

Phagocytosis occurs upon recognition of microbes by macrophage cell surface receptors including the FcγRs, complement receptors, integrins, and scavenger receptors. The FcγRs recognize the Fc domains of IgGs to promote engulfment of foreign particles by phagocytosis. The FcγRs have ITAM domains that can be phosphorylated by Hck and Lyn (67;68).  FcγR phosphorylation recruits Syk as well as proline-rich tyrosine kinase-2 (Pyk-2), which facilitate actin reorganization. Class A scavenger receptors (SR-As) interact with several ligands including low-density lipoproteins (LDLs), lipoteichoic acid (LTA), and poly I:C to facilitate gene transcription and TNF-α, IL-1β, and IL-6 release. Lyn is a positive regulator of macrophage adhesion through the SR-As (69). Lyn also phosphorylates ITIMs in PIR-B and signal-regulatory protein alpha (SIRPα) in macrophages to negatively regulate phagocytosis through the recruitment of SHP-1 and SHP-2 [reviewed in (29;70)].

 

-Mast cells

FcεRI, an antigen receptor found on mast cells, is phosphorylated by Lyn at ITAMs in the cytoplasmic tail of the receptor. The FcεRI signaling pathway shares homology with the BCR and FcγR signaling pathways. In mast cells, Lyn has a positive functional role in SCF-induced chemotaxis, a redundant positive role in FcεRI-stimulated responses, and a negative regulatory role in FcεRI-stimulated responses (i.e., degranulation, proliferation and cytokine production) [(36;44-46); reviewed in (29)].

 

-Dendritic cells

Lyn is involved in the regulation of dendritic cell (DC) GM-CSF-stimulated maturation, proliferation, and survival (71;72). In Lyn^-/- mice, loss of Lyn expression resulted in enhanced DC expansion from bone marrow precursors as well as accelerated differentiation of DC progenitors; however the bone marrow-derived DCs exhibited a less mature phenotype and a reduced capacity to stimulate antigen-specific T cells (71). In addition, Lyn^-/- DCs had higher survival rates after differentiation than wild-type cells (71). Lyn^-/- DCs were unable to mature appropriately in response to innate stimuli, leading to DCs that had lower levels of MHC class II and costimulatory molecules (71). IL-12 production and antigen-specific T cell activation were reduced in Lyn^-/- DCs after maturation, leading to impaired T helper type 1 (Th1) responses (71). Diminished IL-12 synthesis in the DCs was due to hyperactivation of the PI3K pathway (72). DC-specific Lyn (DC-Lyn) knockout mice exhibited spontaneous activation of B and T cells, the development of autoantibodies, severe nephritis (73). DCs from the DC-Lyn mice were hyperactivated and hyperresponsive to TLR agonist, GM-CSF, and IL-1β stimulation (73). After LPS or IL-1β stimulation, Lyn-deficient DCs exhibited increased phosphorylation and degradation of IκBα, indicating that NF-κB signaling was increased.

 

-Eosinophils

Lyn associates with the IL-5 receptor (IL-5R) alpha (IL-5Rα) subunit and phosphorylates ITAMs in both the IL-5Rα and β subunits to positively regulate IL-5-induced differentiation, proliferation, survival, and activation in eosinophils [(72;74-76); reviewed in (29)].  Lyn also has a positive role in IL-3/GM-CSF-induced survival (74;75) and in Fas-mediated cell death (77); see the record for riogrande for more information on Fas/FasL-mediated cell death.

 

-Erythroblasts

Lyn is essential for both (EpoR)-induced early erythroid cell expansion and late-stage maturation and cell survival; loss of Lyn expression prevented erythroid differentiation in response to erythropoietin (37;78-80). In EpoR signaling, activated Lyn phosphorylates STAT5 (50;79). Lyn also stimulates pathways that downregulate EpoR signaling (41).

 

-Osteoclasts

Lyn is a negative regulator of osteoclastic bone resorption and differentiation of osteoclast precursors in response to receptor activator of NF-kappaB (RANK) ligand (RANKL); Lyn forms a complex with RANK, SHP-1, and Grb2-associated binder 2 (Gab2).  See the record for xander for more information on the function of RANK in the non-canonical NF-κB pathway. Osteoclasts from Lyn^-/- mice exhibited increased Gab2 phosphorylation as well as increased JNK and NF-κB activity. As a result, Lyn^-/- mice showed accelerated osteoclastogenesis and bone loss in response to RANKL (81).

 

Lyn function in the brain

In the brain, Lyn physically associates with the α-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptor and is activated after receptor stimulation. Following Lyn activation, the MAPK pathway regulates the expression of brain-derived neurotrophic factor (BDNF) to mediate fast synaptic transmission (82). Lyn negatively regulates the N-methyl-D-aspartate (NMDA) pathway in controlling striatum- and nucleus accumbens-regulated motor activity (30). In NMDA signaling, Lyn inhibits PKC activity, which is responsible for the phosphorylation of the NR1 regulatory subunit of the NMDA receptor (83). Lyn^-/- mice did not move normally in a new environment due to an enhancement in NMDA signaling upon the loss of Lyn expression; the dopaminergic pathway was normal (30).

 

Leukemia and Tumors

In the mouse, Lyn is a proposed tumor suppressor; this function is affected by the genetic background of mouse models and by other environmental factors including chronic infection and the spectrum of commensal flora [reviewed in (29)]. Lyn^-/- mice older than one year of age can develop large aggregates of myelomonocytic cells on the tail, ears, and legs due to hyperresponsiveness to cytokine stimulation [(41); reviewed in (29)]. In cell lines established from patients with chronic myelogenous leukemia (CML) and acute myeloid leukemia (AML), Lyn is hyperactivated [(84); reviewed in (29)]. Lyn is essential in maintaining AML cell proliferation and anti-apoptotic pathways (85). Lyn also regulates the activation of the Akt anti-apoptotic pathway in colon carcinoma cells (86). In prostate cancer cell lines, inhibition of Lyn resulted in reduced cell proliferation (87).

Putative Mechanism

The Lemon phenotype is similar to that observed in the Lyn^-/- and Lyn^weeb (WeeB) mouse models indicating that Lyn^Lemon has reduced function. Lyn knockout (Lyn^-/-; Lyn^tm1Sor, Lyn^tm1Tya, and Lyn^tm1Sor) mice exhibit normal B lineage compartments through to the transitional stage in the spleen (34;58;88;89). Lyn^-/- transitional 1 (T1) B cells develop normally, but T2 B cells develop primarily from the T1 subset in the spleen and fail to develop from immature B cells in the bone marrow (52;90). Transitional and maturing B cells in the Lyn^-/- mice undergo increased death rates in the T2 and mature subsets; most dying cells do not pass through the anergic T3 stage (52). Lyn^-/- mice exhibit normal frequency of pro-B cells, indicating that Lyn does not control pro-B cell proliferation or survival and/or that it plays a redundant role therein (34;58;88;91). Lyn^-/- mice exhibit progressive splenomegaly and enlargement of lymph nodes, reduced numbers of mature follicular B cells, absence of marginal zone B cells, produce large quantities of anti-nuclear antibodies, and develop glomerulonephritis as early as 5 months of age (34;58;88;89). B cells from Lyn^-/- mice are both hyperresponsive to BCR ligation and resistant to the inhibitory signals from FcγRIIb and CD22 (34;59-61). Peritoneal IgM⁺ B220⁺ B cell numbers were significantly lower in Lyn^-/- mice at 2 months of age compared to wild-type mice and the size of the Peyer’s patches were reduced (58;89). As a result, CD5⁻ B220^high conventional B cells and B1 cells were also reduced (89). WeeB mice, have an ENU-induced mutation within the kinase domain resulting in perturbed BCR signaling (16). The WeeB mice have ~50% reduced peripheral blood B cell numbers. The numbers of all splenic B cell subsets and of mature B220^highIgM⁺ recirculating B cells were reduced in the WeeB mice at less severe amounts than in the Lyn^-/- mice. With age, the WeeB mice develop enlarged spleens with an accumulation of lymphoblast-like and plasma cells, reduced B cell numbers, and disrupted B cell zone organization. The WeeB mice exhibit a later glomerulonephritis onset (12-14 months) than Lyn^-/- mice (~8 months).

Primers

PCR Primer
Lemon_pcr_F: GGCCAGGTCATACTTCCTGTTTTGTT
Lemon_pcr_R: TGAAACTGTGCCTACACAACCAACC

Sequencing Primer
Lemon_seq_F: GATTCCCCTGCTTCTGCC
Lemon_seq_R: TGTTCATCCCCAGCCAAG

Genotyping

Lemon genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.

 

PCR Primers

Lemon(F): 5’- GGCCAGGTCATACTTCCTGTTTTGTT -3’

Lemon(R): 5’- TGAAACTGTGCCTACACAACCAACC -3’

 

Sequencing Primers

Lemon_seq(F): 5’- GATTCCCCTGCTTCTGCC -3’

Lemon_seq(F): 5’- TGTTCATCCCCAGCCAAG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 974 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Lyn) is amplified:

 

68171            ggccaggtca tacttcctgt tttgttgtgt tattatgaaa gtgaatccta

68221 agtgtcaaga ggaaactcaa aataattgtt ctattcagct aaatgatttt ggaaaactac    

68281 ggtgaagaag aaaagtgata tattgcctac ttgtctagca aacaaattgc tattgtcatt    

68341 tatcaagtca aaaatttaaa gtaccttgta ttttcccttt gaggccttgg ctagcctggt    

68401 attagcatag attcccctgc ttctgcctcc cacgtgcctg ggctaaaatc atcactgcac    

68461 aaggctgcag agctttcatg tgatgaggtt gtatttgtat gtttcatggt aaaatggtta    

68521 tcacagtgtg gtataatgta gaccttatta ataacatata aacatgcctt ctcttaactg     

68581 ttttccacag gaagcttctc tctttctgtc agagattatg accctatgca tggtgatgtc    

68641 attaagcact acaaaattag aagtctggac aatggtggct attacatctc tcctcgcatc    

68701 acttttccct gcatcagtga catgattaag cattaccaaa gtaagtcaaa actgaaggcc    

68761 gggagaggca gattatcttt ataatgatta gtgtaaagtg gcaaatgcta ctttatagaa    

68821 attgtttcct tcaggtaatg ccatgggtag tactctacaa gtagttctaa cttaatgtag    

68881 atactccttg acttccagtg atcacgtgtt ctaatatgtc cattgtgact tgacatatta    

68941 taagttgaaa atacatttca ttcgccctat cttctgaaca ccctagctta atgtagccat    

69001 cagtgagtgt gctcaggtac ttacatttcc ctacagttgg acagagtcta tcccctgtat    

69061 aacctctgtg tgctagtggc tcatgcaagc tgccaagtac ttggctgggg atgaacacag    

69121 gttggttgtg taggcacagt ttcat

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References

  1. Stanley, E., Ralph, S., McEwen, S., Boulet, I., Holtzman, D. A., Lock, P., and Dunn, A. R. (1991) Alternatively Spliced Murine Lyn mRNAs Encode Distinct Proteins. Mol Cell Biol. 11, 3399-3406.

  2. Yi, T. L., Bolen, J. B., and Ihle, J. N. (1991) Hematopoietic Cells Express Two Forms of Lyn Kinase Differing by 21 Amino Acids in the Amino Terminus. Mol Cell Biol. 11, 2391-2398.

  3. Hibbs, M. L., and Dunn, A. R. (1997) Lyn, a Src-Like Tyrosine Kinase. Int J Biochem Cell Biol. 29, 397-400.

  4. Kurosaki, T., and Hikida, M. (2009) Tyrosine Kinases and their Substrates in B Lymphocytes. Immunol Rev. 228, 132-148.

  5. Schwartzberg, P. L. (1998) The Many Faces of Src: Multiple Functions of a Prototypical Tyrosine Kinase. Oncogene. 17, 1463-1468.

  6. Boggon, T. J., and Eck, M. J. (2004) Structure and Regulation of Src Family Kinases. Oncogene. 23, 7918-7927.

  7. Rudd, C. E., Trevillyan, J. M., Dasgupta, J. D., Wong, L. L., and Schlossman, S. F. (1988) The CD4 Receptor is Complexed in Detergent Lysates to a Protein-Tyrosine Kinase (pp58) from Human T Lymphocytes. Proc Natl Acad Sci U S A. 85, 5190-5194.

  8. Veillette, A., Bookman, M. A., Horak, E. M., and Bolen, J. B. (1988) The CD4 and CD8 T Cell Surface Antigens are Associated with the Internal Membrane Tyrosine-Protein Kinase p56lck. Cell. 55, 301-308.

  9. Kovarova, M., Tolar, P., Arudchandran, R., Draberova, L., Rivera, J., and Draber, P. (2001) Structure-Function Analysis of Lyn Kinase Association with Lipid Rafts and Initiation of Early Signaling Events After Fcepsilon Receptor I Aggregation. Mol Cell Biol. 21, 8318-8328.

  10. Yu, H., Chen, J. K., Feng, S., Dalgarno, D. C., Brauer, A. W., and Schreiber, S. L. (1994) Structural Basis for the Binding of Proline-Rich Peptides to SH3 Domains. Cell. 76, 933-945.

  11. Bauer, F., Schweimer, K., Meiselbach, H., Hoffmann, S., Rosch, P., and Sticht, H. (2005) Structural Characterization of Lyn-SH3 Domain in Complex with a Herpesviral Protein Reveals an Extended Recognition Motif that Enhances Binding Affinity. Protein Sci. 14, 2487-2498.

  12. Zhu, X., Kim, J. L., Newcomb, J. R., Rose, P. E., Stover, D. R., Toledo, L. M., Zhao, H., and Morgenstern, K. A. (1999) Structural Analysis of the Lymphocyte-Specific Kinase Lck in Complex with Non-Selective and Src Family Selective Kinase Inhibitors. Structure. 7, 651-661.

  13. Xu, W., Harrison, S. C., and Eck, M. J. (1997) Three-Dimensional Structure of the Tyrosine Kinase c-Src. Nature. 385, 595-602.

  14. Yamaguchi, H., and Hendrickson, W. A. (1996) Structural Basis for Activation of Human Lymphocyte Kinase Lck upon Tyrosine Phosphorylation. Nature. 384, 484-489.

  15. Sicheri, F., and Kuriyan, J. (1997) Structures of Src-Family Tyrosine Kinases. Curr Opin Struct Biol. 7, 777-785.

  16. Barouch-Bentov, R., Che, J., Lee, C. C., Yang, Y., Herman, A., Jia, Y., Velentza, A., Watson, J., Sternberg, L., Kim, S., Ziaee, N., Miller, A., Jackson, C., Fujimoto, M., Young, M., Batalov, S., Liu, Y., Warmuth, M., Wiltshire, T., Cooke, M. P., and Sauer, K. (2009) A Conserved Salt Bridge in the G Loop of Multiple Protein Kinases is Important for Catalysis and for in Vivo Lyn Function. Mol Cell. 33, 43-52.

  17. Williams, N. K., Lucet, I. S., Klinken, S. P., Ingley, E., and Rossjohn, J. (2009) Crystal Structures of the Lyn Protein Tyrosine Kinase Domain in its Apo- and Inhibitor-Bound State. J Biol Chem. 284, 284-291.

  18. Aimes, R. T., Hemmer, W., and Taylor, S. S. (2000) Serine-53 at the Tip of the Glycine-Rich Loop of cAMP-Dependent Protein Kinase: Role in Catalysis, P-Site Specificity, and Interaction with Inhibitors. Biochemistry. 39, 8325-8332.

  19. Grant, B. D., Hemmer, W., Tsigelny, I., Adams, J. A., and Taylor, S. S. (1998) Kinetic Analyses of Mutations in the Glycine-Rich Loop of cAMP-Dependent Protein Kinase. Biochemistry. 37, 7708-7715.

  20. Cowan-Jacob, S. W., Fendrich, G., Manley, P. W., Jahnke, W., Fabbro, D., Liebetanz, J., and Meyer, T. (2005) The Crystal Structure of a c-Src Complex in an Active Conformation Suggests Possible Steps in c-Src Activation. Structure. 13, 861-871.

  21. Williams, J. C., Weijland, A., Gonfloni, S., Thompson, A., Courtneidge, S. A., Superti-Furga, G., and Wierenga, R. K. (1997) The 2.35 A Crystal Structure of the Inactivated Form of Chicken Src: A Dynamic Molecule with Multiple Regulatory Interactions. J Mol Biol. 274, 757-775.

  22. Gonfloni, S., Williams, J. C., Hattula, K., Weijland, A., Wierenga, R. K., and Superti-Furga, G. (1997) The Role of the Linker between the SH2 Domain and Catalytic Domain in the Regulation and Function of Src. EMBO J. 16, 7261-7271.

  23. Young, M. A., Gonfloni, S., Superti-Furga, G., Roux, B., and Kuriyan, J. (2001) Dynamic Coupling between the SH2 and SH3 Domains of c-Src and Hck Underlies their Inactivation by C-Terminal Tyrosine Phosphorylation. Cell. 105, 115-126.

  24. Yanagi, S., Sugawara, H., Kurosaki, M., Sabe, H., Yamamura, H., and Kurosaki, T. (1996) CD45 Modulates Phosphorylation of both Autophosphorylation and Negative Regulatory Tyrosines of Lyn in B Cells. J Biol Chem. 271, 30487-30492.

  25. Justement, L. B., Campbell, K. S., Chien, N. C., and Cambier, J. C. (1991) Regulation of B Cell Antigen Receptor Signal Transduction and Phosphorylation by CD45. Science. 252, 1839-1842.

  26. Gonfloni, S., Weijland, A., Kretzschmar, J., and Superti-Furga, G. (2000) Crosstalk between the Catalytic and Regulatory Domains Allows Bidirectional Regulation of Src. Nat Struct Biol. 7, 281-286.

  27. Yamanashi, Y., Mori, S., Yoshida, M., Kishimoto, T., Inoue, K., Yamamoto, T., and Toyoshima, K. (1989) Selective Expression of a Protein-Tyrosine Kinase, p56lyn, in Hematopoietic Cells and Association with Production of Human T-Cell Lymphotropic Virus Type I. Proc Natl Acad Sci U S A. 86, 6538-6542.

  28. Umemori, H., Wanaka, A., Kato, H., Takeuchi, M., Tohyama, M., and Yamamoto, T. (1992) Specific Expressions of Fyn and Lyn, Lymphocyte Antigen Receptor-Associated Tyrosine Kinases, in the Central Nervous System. Brain Res Mol Brain Res. 16, 303-310.

  29. Scapini, P., Pereira, S., Zhang, H., and Lowell, C. A. (2009) Multiple Roles of Lyn Kinase in Myeloid Cell Signaling and Function. Immunol Rev. 228, 23-40.

  30. Umemori, H., Ogura, H., Tozawa, N., Mikoshiba, K., Nishizumi, H., and Yamamoto, T. (2003) Impairment of N-Methyl-D-Aspartate Receptor-Controlled Motor Activity in LYN-Deficient Mice. Neuroscience. 118, 709-713.

  31. Chen, S., Bing, R., Rosenblum, N., and Hillman, D. E. (1996) Immunohistochemical Localization of Lyn (p56) Protein in the Adult Rat Brain. Neuroscience. 71, 89-100.

  32. Brown, M. T., and Cooper, J. A. (1996) Regulation, Substrates and Functions of Src. Biochim Biophys Acta. 1287, 121-149.

  33. Erpel, T., and Courtneidge, S. A. (1995) Src Family Protein Tyrosine Kinases and Cellular Signal Transduction Pathways. Curr Opin Cell Biol. 7, 176-182.

  34. Chan, V. W., Meng, F., Soriano, P., DeFranco, A. L., and Lowell, C. A. (1997) Characterization of the B Lymphocyte Populations in Lyn-Deficient Mice and the Role of Lyn in Signal Initiation and Down-Regulation. Immunity. 7, 69-81.

  35. Janas, M. L., Hodgkin, P., Hibbs, M., and Tarlinton, D. (1999) Genetic Evidence for Lyn as a Negative Regulator of IL-4 Signaling. J Immunol. 163, 4192-4198.

  36. O'Laughlin-Bunner, B., Radosevic, N., Taylor, M. L., Shivakrupa, DeBerry, C., Metcalfe, D. D., Zhou, M., Lowell, C., and Linnekin, D. (2001) Lyn is Required for Normal Stem Cell Factor-Induced Proliferation and Chemotaxis of Primary Hematopoietic Cells. Blood. 98, 343-350.

  37. Karur, V. G., Lowell, C. A., Besmer, P., Agosti, V., and Wojchowski, D. M. (2006) Lyn Kinase Promotes Erythroblast Expansion and Late-Stage Development. Blood. 108, 1524-1532.

  38. Yin, H., Liu, J., Li, Z., Berndt, M. C., Lowell, C. A., and Du, X. (2008) Src Family Tyrosine Kinase Lyn Mediates VWF/GPIb-IX-Induced Platelet Activation Via the cGMP Signaling Pathway. Blood. 112, 1139-1146.

  39. Maxwell, M. J., Yuan, Y., Anderson, K. E., Hibbs, M. L., Salem, H. H., and Jackson, S. P. (2004) SHIP1 and Lyn Kinase Negatively Regulate Integrin Alpha IIb Beta 3 Signaling in Platelets. J Biol Chem. 279, 32196-32204.

  40. Lannutti, B. J., and Drachman, J. G. (2004) Lyn Tyrosine Kinase Regulates Thrombopoietin-Induced Proliferation of Hematopoietic Cell Lines and Primary Megakaryocytic Progenitors. Blood. 103, 3736-3743.

  41. Harder, K. W., Parsons, L. M., Armes, J., Evans, N., Kountouri, N., Clark, R., Quilici, C., Grail, D., Hodgson, G. S., Dunn, A. R., and Hibbs, M. L. (2001) Gain- and Loss-of-Function Lyn Mutant Mice Define a Critical Inhibitory Role for Lyn in the Myeloid Lineage. Immunity. 15, 603-615.

  42. Wei, S., Liu, J. H., Epling-Burnette, P. K., Gamero, A. M., Ussery, D., Pearson, E. W., Elkabani, M. E., Diaz, J. I., and Djeu, J. Y. (1996) Critical Role of Lyn Kinase in Inhibition of Neutrophil Apoptosis by Granulocyte-Macrophage Colony-Stimulating Factor. J Immunol. 157, 5155-5162.

  43. Linnekin, D., DeBerry, C. S., and Mou, S. (1997) Lyn Associates with the Juxtamembrane Region of c-Kit and is Activated by Stem Cell Factor in Hematopoietic Cell Lines and Normal Progenitor Cells. J Biol Chem. 272, 27450-27455.

  44. Rivera, J., and Olivera, A. (2008) A Current Understanding of Fc Epsilon RI-Dependent Mast Cell Activation. Curr Allergy Asthma Rep. 8, 14-20.

  45. Furumoto, Y., Gomez, G., Gonzalez-Espinosa, C., Kovarova, M., Odom, S., Ryan, J. J., and Rivera, J. (2005) The Role of Src Family Kinases in Mast Cell Effector Function. Novartis Found Symp. 271, 39-47; discussion 47-53, 95-9.

  46. Hernandez-Hansen, V., Mackay, G. A., Lowell, C. A., Wilson, B. S., and Oliver, J. M. (2004) The Src Kinase Lyn is a Negative Regulator of Mast Cell Proliferation. J Leukoc Biol. 75, 143-151.

  47. Pereira, S., and Lowell, C. (2003) The Lyn Tyrosine Kinase Negatively Regulates Neutrophil Integrin Signaling. J Immunol. 171, 1319-1327.

  48. Lowell, C. A., Fumagalli, L., and Berton, G. (1996) Deficiency of Src Family Kinases p59/61hck and p58c-Fgr Results in Defective Adhesion-Dependent Neutrophil Functions. J Cell Biol. 133, 895-910.

  49. Mocsai, A., Ligeti, E., Lowell, C. A., and Berton, G. (1999) Adhesion-Dependent Degranulation of Neutrophils Requires the Src Family Kinases Fgr and Hck. J Immunol. 162, 1120-1126.

  50. Chin, H., Arai, A., Wakao, H., Kamiyama, R., Miyasaka, N., and Miura, O. (1998) Lyn Physically Associates with the Erythropoietin Receptor and may Play a Role in Activation of the Stat5 Pathway. Blood. 91, 3734-3745.

  51. Corey, S. J., Burkhardt, A. L., Bolen, J. B., Geahlen, R. L., Tkatch, L. S., and Tweardy, D. J. (1994) Granulocyte Colony-Stimulating Factor Receptor Signaling Involves the Formation of a Three-Component Complex with Lyn and Syk Protein-Tyrosine Kinases. Proc Natl Acad Sci U S A. 91, 4683-4687.

  52. Avila, M., Martinez-Juarez, A., Ibarra-Sanchez, A., and Gonzalez-Espinosa, C. (2012) Lyn Kinase Controls TLR4-Dependent IKK and MAPK Activation Modulating the Activity of TRAF-6/TAK-1 Protein Complex in Mast Cells. Innate Immun. 18, 648-660.

  53. Verhagen, A. M., Wallace, M. E., Goradia, A., Jones, S. A., Croom, H. A., Metcalf, D., Collinge, J. E., Maxwell, M. J., Hibbs, M. L., Alexander, W. S., Hilton, D. J., Kile, B. T., and Starr, R. (2009) A Kinase-Dead Allele of Lyn Attenuates Autoimmune Disease Normally Associated with Lyn Deficiency. J Immunol. 182, 2020-2029.

  54. Yamamoto, T., Yamanashi, Y., and Toyoshima, K. (1993) Association of Src-Family Kinase Lyn with B-Cell Antigen Receptor. Immunol Rev. 132, 187-206.

  55. Hashimoto, S., Iwamatsu, A., Ishiai, M., Okawa, K., Yamadori, T., Matsushita, M., Baba, Y., Kishimoto, T., Kurosaki, T., and Tsukada, S. (1999) Identification of the SH2 Domain Binding Protein of Bruton's Tyrosine Kinase as BLNK--Functional Significance of Btk-SH2 Domain in B-Cell Antigen Receptor-Coupled Calcium Signaling. Blood. 94, 2357-2364.

  56. Koretzky, G. A., Abtahian, F., and Silverman, M. A. (2006) SLP76 and SLP65: Complex Regulation of Signalling in Lymphocytes and Beyond. Nat Rev Immunol. 6, 67-78.

  57. Guo, B., Su, T. T., and Rawlings, D. J. (2004) Protein Kinase C Family Functions in B-Cell Activation. Curr Opin Immunol. 16, 367-373.

  58. Nishizumi, H., Taniuchi, I., Yamanashi, Y., Kitamura, D., Ilic, D., Mori, S., Watanabe, T., and Yamamoto, T. (1995) Impaired Proliferation of Peripheral B Cells and Indication of Autoimmune Disease in Lyn-Deficient Mice. Immunity. 3, 549-560.

  59. Nishizumi, H., Horikawa, K., Mlinaric-Rascan, I., and Yamamoto, T. (1998) A Double-Edged Kinase Lyn: A Positive and Negative Regulator for Antigen Receptor-Mediated Signals. J Exp Med. 187, 1343-1348.

  60. Chan, V. W., Lowell, C. A., and DeFranco, A. L. (1998) Defective Negative Regulation of Antigen Receptor Signaling in Lyn-Deficient B Lymphocytes. Curr Biol. 8, 545-553.

  61. Smith, K. G., Tarlinton, D. M., Doody, G. M., Hibbs, M. L., and Fearon, D. T. (1998) Inhibition of the B Cell by CD22: A Requirement for Lyn. J Exp Med. 187, 807-811.

  62. Maeda, A., Kurosaki, M., Ono, M., Takai, T., and Kurosaki, T. (1998) Requirement of SH2-Containing Protein Tyrosine Phosphatases SHP-1 and SHP-2 for Paired Immunoglobulin-Like Receptor B (PIR-B)-Mediated Inhibitory Signal. J Exp Med. 187, 1355-1360.

  63. Ho, L. H., Uehara, T., Chen, C. C., Kubagawa, H., and Cooper, M. D. (1999) Constitutive Tyrosine Phosphorylation of the Inhibitory Paired Ig-Like Receptor PIR-B. Proc Natl Acad Sci U S A. 96, 15086-15090.

  64. O'Shea, J. J., and Murray, P. J. (2008) Cytokine Signaling Modules in Inflammatory Responses. Immunity. 28, 477-487.

  65. Jia, S. H., Parodo, J., Kapus, A., Rotstein, O. D., and Marshall, J. C. (2008) Dynamic Regulation of Neutrophil Survival through Tyrosine Phosphorylation Or Dephosphorylation of Caspase-8. J Biol Chem. 283, 5402-5413.

  66. Gardai, S., Whitlock, B. B., Helgason, C., Ambruso, D., Fadok, V., Bratton, D., and Henson, P. M. (2002) Activation of SHIP by NADPH Oxidase-Stimulated Lyn Leads to Enhanced Apoptosis in Neutrophils. J Biol Chem. 277, 5236-5246.

  67. Strzelecka-Kiliszek, A., Kwiatkowska, K., and Sobota, A. (2002) Lyn and Syk Kinases are Sequentially Engaged in Phagocytosis Mediated by Fc Gamma R. J Immunol. 169, 6787-6794.

  68. Fitzer-Attas, C. J., Lowry, M., Crowley, M. T., Finn, A. J., Meng, F., DeFranco, A. L., and Lowell, C. A. (2000) Fcgamma Receptor-Mediated Phagocytosis in Macrophages Lacking the Src Family Tyrosine Kinases Hck, Fgr, and Lyn. J Exp Med. 191, 669-682.

  69. Nikolic, D. M., Cholewa, J., Gass, C., Gong, M. C., and Post, S. R. (2007) Class A Scavenger Receptor-Mediated Cell Adhesion Requires the Sequential Activation of Lyn and PI3-Kinase. Am J Physiol Cell Physiol. 292, C1450-8.

  70. Barclay, A. N., and Brown, M. H. (2006) The SIRP Family of Receptors and Immune Regulation. Nat Rev Immunol. 6, 457-464.

  71. Chu, C. L., and Lowell, C. A. (2005) The Lyn Tyrosine Kinase Differentially Regulates Dendritic Cell Generation and Maturation. J Immunol. 175, 2880-2889.

  72. Beavitt, S. J., Harder, K. W., Kemp, J. M., Jones, J., Quilici, C., Casagranda, F., Lam, E., Turner, D., Brennan, S., Sly, P. D., Tarlinton, D. M., Anderson, G. P., and Hibbs, M. L. (2005) Lyn-Deficient Mice Develop Severe, Persistent Asthma: Lyn is a Critical Negative Regulator of Th2 Immunity. J Immunol. 175, 1867-1875.

  73. Lamagna, C., Scapini, P., van Ziffle, J. A., DeFranco, A. L., and Lowell, C. A. (2013) Hyperactivated MyD88 Signaling in Dendritic Cells, through Specific Deletion of Lyn Kinase, Causes Severe Autoimmunity and Inflammation. Proc Natl Acad Sci U S A. 110, E3311-20.

  74. Stafford, S., Lowell, C., Sur, S., and Alam, R. (2002) Lyn Tyrosine Kinase is Important for IL-5-Stimulated Eosinophil Differentiation. J Immunol. 168, 1978-1983.

  75. Yousefi, S., Hoessli, D. C., Blaser, K., Mills, G. B., and Simon, H. U. (1996) Requirement of Lyn and Syk Tyrosine Kinases for the Prevention of Apoptosis by Cytokines in Human Eosinophils. J Exp Med. 183, 1407-1414.

  76. Adachi, T., Stafford, S., Sur, S., and Alam, R. (1999) A Novel Lyn-Binding Peptide Inhibitor Blocks Eosinophil Differentiation, Survival, and Airway Eosinophilic Inflammation. J Immunol. 163, 939-946.

  77. Simon, H. U., Yousefi, S., Dibbert, B., Hebestreit, H., Weber, M., Branch, D. R., Blaser, K., Levi-Schaffer, F., and Anderson, G. P. (1998) Role for Tyrosine Phosphorylation and Lyn Tyrosine Kinase in Fas Receptor-Mediated Apoptosis in Eosinophils. Blood. 92, 547-557.

  78. Harder, K. W., Quilici, C., Naik, E., Inglese, M., Kountouri, N., Turner, A., Zlatic, K., Tarlinton, D. M., and Hibbs, M. L. (2004) Perturbed myelo/erythropoiesis in Lyn-Deficient Mice is Similar to that in Mice Lacking the Inhibitory Phosphatases SHP-1 and SHIP-1. Blood. 104, 3901-3910.

  79. Tilbrook, P. A., Ingley, E., Williams, J. H., Hibbs, M. L., and Klinken, S. P. (1997) Lyn Tyrosine Kinase is Essential for Erythropoietin-Induced Differentiation of J2E Erythroid Cells. EMBO J. 16, 1610-1619.

  80. Slavova-Azmanova, N. S., Kucera, N., Satiaputra, J., Stone, L., Magno, A., Maxwell, M. J., Quilici, C., Erber, W., Klinken, S. P., Hibbs, M. L., and Ingley, E. (2013) Gain-of-Function Lyn Induces Anemia: Appropriate Lyn Activity is Essential for Normal Erythropoiesis and Epo Receptor Signaling. Blood. 122, 262-271.

  81. Kim, H. J., Zhang, K., Zhang, L., Ross, F. P., Teitelbaum, S. L., and Faccio, R. (2009) The Src Family Kinase, Lyn, Suppresses Osteoclastogenesis in Vitro and in Vivo. Proc Natl Acad Sci U S A. 106, 2325-2330.

  82. Hayashi, T., Umemori, H., Mishina, M., and Yamamoto, T. (1999) The AMPA Receptor Interacts with and Signals through the Protein Tyrosine Kinase Lyn. Nature. 397, 72-76.

  83. Swope, S. L., Moss, S. J., Raymond, L. A., and Huganir, R. L. (1999) Regulation of Ligand-Gated Ion Channels by Protein Phosphorylation. Adv Second Messenger Phosphoprotein Res. 33, 49-78.

  84. Roginskaya, V., Zuo, S., Caudell, E., Nambudiri, G., Kraker, A. J., and Corey, S. J. (1999) Therapeutic Targeting of Src-Kinase Lyn in Myeloid Leukemic Cell Growth. Leukemia. 13, 855-861.

  85. Dos Santos, C., Demur, C., Bardet, V., Prade-Houdellier, N., Payrastre, B., and Recher, C. (2008) A Critical Role for Lyn in Acute Myeloid Leukemia. Blood. 111, 2269-2279.

  86. Bates, R. C., Edwards, N. S., Burns, G. F., and Fisher, D. E. (2001) A CD44 Survival Pathway Triggers Chemoresistance Via Lyn Kinase and Phosphoinositide 3-kinase/Akt in Colon Carcinoma Cells. Cancer Res. 61, 5275-5283.

  87. Goldenberg-Furmanov, M., Stein, I., Pikarsky, E., Rubin, H., Kasem, S., Wygoda, M., Weinstein, I., Reuveni, H., and Ben-Sasson, S. A. (2004) Lyn is a Target Gene for Prostate Cancer: Sequence-Based Inhibition Induces Regression of Human Tumor Xenografts. Cancer Res. 64, 1058-1066.

  88. Hibbs, M. L., Tarlinton, D. M., Armes, J., Grail, D., Hodgson, G., Maglitto, R., Stacker, S. A., and Dunn, A. R. (1995) Multiple Defects in the Immune System of Lyn-Deficient Mice, Culminating in Autoimmune Disease. Cell. 83, 301-311.

  89. Hasegawa, M., Fujimoto, M., Poe, J. C., Steeber, D. A., Lowell, C. A., and Tedder, T. F. (2001) A CD19-Dependent Signaling Pathway Regulates Autoimmunity in Lyn-Deficient Mice. J Immunol. 167, 2469-2478.

  90. Meade, J., Fernandez, C., and Turner, M. (2002) The Tyrosine Kinase Lyn is Required for B Cell Development Beyond the T1 Stage in the Spleen: Rescue by Over-Expression of Bcl-2. Eur J Immunol. 32, 1029-1034.

  91. Hibbs, M. L., Harder, K. W., Armes, J., Kountouri, N., Quilici, C., Casagranda, F., Dunn, A. R., and Tarlinton, D. M. (2002) Sustained Activation of Lyn Tyrosine Kinase in Vivo Leads to Autoimmunity. J Exp Med. 196, 1593-1604.