Phenotypic Mutation 'whisper' (pdf version)
Allelewhisper
Mutation Type missense
Chromosome11
Coordinate80,484,332 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Myo1d
Gene Name myosin ID
Synonym(s) 9930104H07Rik, D11Ertd9e
Chromosomal Location 80,482,126-80,780,025 bp (-)
Accession Number

NCBI RefSeq: NM_177390; MGI:107728

MappedYes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000037819]
AlphaFold Q5SYD0
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: L972P

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
(Using ENSMUST00000041065)
Meta Mutation Damage Score 0.9132 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotype question? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
FACS NK1.1+ T cells - increased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.968; ML prob: 0.9692; human score: 6.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-10-11 1:56 PM by Anne Murray
Record Created 2013-03-02 4:41 PM by Emre Turer
Record Posted 2018-10-11
Phenotypic Description

 

 

 

Figure 1. Whisper mice exhibited weight loss after 7 days of treatment with DSS. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 1. Whisper mice exhibited additional weight loss at day 10 of the DSS-induced colitis screen. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The whisper phenotype was identified among G3 mice of the pedigree R0096, some of which showed susceptibility to dextran sulfate sodium (DSS)-induced colitis exhibiting . diarrhea and rectal bleeding as well as weight loss by seven days after exposure to DSS (Figure 1); weight loss continued to progress through day 10 post-DSS treatment (Figure 2).

Nature of Mutation

Gene validated by crossing to 2nd ENU allele.  Horton/Whisper compound heterozygous mice are DSS sensitive.

 

 

Figure 3. Linkage mapping of the reduced body weight at day 10 of the DSS-induced colitis screen using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted versus the chromosomal positions of 69 mutations (X-axis) identified in the G1 male of pedigree R0096.  Raw phenotype data were used for single locus linkage analysis without consideration for G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and P = 7.246 x 10-4 for Bonferroni significance, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 69 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Myo1d: a T to C transition at base pair 80,484,332 (v38) on chromosome 11 corresponding to base pair 295,724 in the GenBank genomic region NC_000077 encoding Myo1d. The strongest association was found with a recessive model of linkage to the DSS-induced weight loss at day 10, wherein 10 affected variant homozygotes departed phenotypically from 16 homozygous reference mice and 24 heterozygous mice with a P value of 1.384 x 10-13 (Figure 3). The mutation corresponds to residue 3,148 in the mRNA sequence NM_177390 within exon 22 of 22 total exons.

 

3132 CCGGTGCAGTGCAGCCTGCACGGGAAGAAATGC
397  -P--V--Q--C--S--L--H--G--K--K--C-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to proline (P) substitution at position 972 (L972P) in the Myo1d protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain structure of myosin 1D.  The head domain contains the actin-binding (not shown) and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains two calmodulin binding IQ motifs.  The C-terminal half of myosin 1D consists of tail homology-1 (TH1) domain. The whisper mutation is a leucine (L) to proline (P) substitution at position 972 (L972P) (red asterisk). This image is interactive. Click on the image to view another mutation found in Myo1d (red). Click on the mutations for more specific information.

Myo1d encodes myosin 1D (Myo1d; alternatively, Myr4), a member of the class I family of unconventional myosins (Figure 4). The class I myosins are molecular motors that control the mechanical properties of cell membranes by mediating membrane/cytoskeleton adhesion (1). The whisper mutation (L972P) is within the TH1 domain of Myo1d. The TH1 domain in class I myosins mediates myosin dimerization, targets each myosin to its subcellular location, binds directly to acidic phospholipids, and specifies the function(s) (e.g., cargo binding and enzymatic activities) of a myosin (2;3).

 

For more information on Myo1d, please see the record for horton.

Putative Mechanism

The apical brush border of the intestinal epithelial cells that line the small intestine is comprised of tightly packed microvilli (4). A core actin bundle and associated actin-binding proteins are essential to maintain the stability of each microvillus (4). Unconventional myosins in the intestine have been studied. Myosin-1a (Myo1a) connects the microvillar membrane to the actin bundle underneath (5-7). Myosins from classes I, II, V, VI, and VII also target to the actin-rich domain in the brush border (8;9). Myo1a has several functions within the enterocyte including the organization of apical membrane domains (10), controlling apical membrane tension (1), and the shedding of vesicles from the tips of the microvilli (11). Knockout of Myo1a (Myo1a-/-) in mice resulted in defects in the brush border membrane composition and apical membrane herniations in some enterocyte brush borders (12), but the knockout mice exhibited no noticeable physiological symptoms indicating that other myosins may compensate for Myo1a. In the wild-type microvillus, Myo1a is excluded from the distal tip compartment where Myo1d localized, indicating that Myo1a and Myo1d have different functions within the microvillus (4). In Myo1a-/- mice, the levels of Myo1d in the brush border are upregulated and redistributed along the length of the microvillus (4). The redistribution of Myo1d upon the loss of Myo1a expression indicates that Myo1d can compensate for the function of Myo1a in the brush border (4). Benesh et al. propose that Myo1d functions in the early stages of vesicle formation at the tips of the microvilli and that the redistribution of Myo1d upon loss of Myo1a expression indicates that Myo1d and Myo1a may compete for a shared binding site within the microvillus (4). The localization of Myo1d to the terminal web, a filamentous structure at the apical surface of epithelial cells that possess microvilli, indicates that Myo1d may function in the short-range transport, docking, and/or fusion of apically directed vesicles derived from the Golgi (13). The Myo1d at the tips of the microvilli may function to control actin dynamics or to transport components along the microvillar axis (4). Alternatively, Myo1d may also function in the formation and/or release of vesicles from the microvillar tips (14).

Primers PCR Primer
whisper_pcr_F: CATTAGAGGGCAGACAGCGATTAGC
whisper_pcr_R: CGGATTGAACCCTGAAACTGCCAC

Sequencing Primer
whisper_seq_F: CCTGGGATGCTGATCGAG
whisper_seq_R: TGCCACCCTACAGGAGC
Genotyping

Whisper genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Whisper(F): 5’- CATTAGAGGGCAGACAGCGATTAGC -3’

Whisper(R): 5’- CGGATTGAACCCTGAAACTGCCAC -3’

 

Sequencing Primer

Whisper_seq(F): 5’- CCTGGGATGCTGATCGAG -3’
 

Whisper_seq(F): 5’- TGCCACCCTACAGGAGC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 440 nucleotides is amplified (Chr.11: 80484074-80484513, GRCm38):

 

cattagaggg cagacagcga ttagctgagc tcctgggatg ctgatcgagg tggaacgagt       

gtggggatgc agaggacgag tgagggcctg cctgcctttt gtgccaggct caggctcttg      

ctcccctggg ccaggcctct gatgtgcagc agtcagttcc cgggcacact gaggatgaag      

cccgagcggt tcttggtgaa gtcaggctgt ggctgattga gccgggtctc cacagagacg      

gtgcatttct tcccgtgcag gctgcactgc accgggttgg tgacgttcac ttgaaggtgg      

cgcttctcac tgcaagagta gaacagacag gccaagcggc cagtgagtgg gcagacacag      

tgctgtggtt tccttggcaa ccctcagggc cctgccattt gccaggctcc tgtagggtgg      

cagtttcagg gttcaatccg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (A>G, Chr. (+) strand; T>C, sense strand).

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsEmre Turer