Phenotypic Mutation 'Mr_magoo'

• Allele: Mr_magoo
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 98,526,745 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Gsdma3
• Gene Name: gasdermin A3
• Synonym(s): Dfl, Bsk, Rim3, Gsdm3, Gsdm1l, Fgn, Rco2
• Chromosomal Location: 98,517,186-98,529,052 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000073022] [ENSMUSP00000103132]
• AlphaFold: Q5Y4Y6
• SMART Domains: Protein: ENSMUSP00000073022; Gene: ENSMUSG00000064224; AA Change: Y344C

Domain	Start	End	E-Value	Type
Pfam:Gasdermin	3	430	1.4e-132	PFAM
low complexity region	438	452	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000073295)
• SMART Domains: Protein: ENSMUSP00000103132; Gene: ENSMUSG00000064224; AA Change: Y335C

Domain	Start	End	E-Value	Type
Pfam:Gasdermin	3	421	9.5e-134	PFAM
low complexity region	429	443	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000107508)
• Meta Mutation Damage Score: 0.9115
• Is this an essential gene?: Probably nonessential (E-score: 0.094)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Live Mice
• MMRRC Submission: 037421-MU
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: 2013-04-10 4:28 PM by Adam Dismang
• Record Posted: 2014-05-30
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Adam Dismang

Accession Number

NCBI RefSeq: NM_001007461; MGI:3044668

Alleles Listed at MGI

All alleles(11) : Targeted(3) Spontaneous(3) Chemically induced(5) 

Phenotypic Description

Figure 1. Representation of the Mr.Magoo phenotype.

The Mr.Magoo phenotype was identified in G1 mice derived from N-ethyl-N-nitrosourea (ENU)-mutagenized C57BL/6J stock. Adult Mr.Magoo homozygous mice exhibit progressive hair loss as well as variable dry skin, dermatitis, and excoriation (Figure 1). The corneas of Mr.Magoo mice are opaque.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 106 mutations. Fifteen G3 mice with the Mr.Magoo phenotype were sequenced at all 106 mutation sites. Of the 15 affected mice, all were heterozygous for a mutation in Gsdma3. Analysis of eight unaffected mice determined that eight were wild-type for the Gsdma3 mutation (-log₁₀[p(non-linkage)] = 6.697; binary variable linkage analysis based on dominant inheritance). Taken together, these results indicate an autosomal dominant or semidominant inheritance pattern for the Mr.Magoo phenotype. The Mr.Magoo mutation is an A to G transition at base pair 98,635,919 on chromosome 11, or base pair 9,560 in the GenBank genomic region NC_000077 encoding Gsdma3. The mutation corresponds to base pair 1,113 in the NM_001007461 mRNA transcript in exon 9 of 11 total exons.

1097 ATGGATGCCATCCTCTACTTCCTCGGGGCTCTG

339  -M--D--A--I--L--Y--F--L--G--A--L-

The mutated nucleotide is indicated in red lettering, and results in a tyrosine (Y) to cysteine (C) substitution at amino acid 344 in the gasderminA3 (GSDMA3) protein.

Protein Prediction

Figure 2. Domain structure of the GSDMA3 protein. GSDMA3 has nine conserved leucine motifs as indicated by the roman numerals. Blue rectangles indicate the three coiled-coil regions with the potential leucine zipper shown in yellow. The gray box indicates a non-conserved amino acid stretch from 227-261. The location of the Mr.Magoo missense mutation is indicated in red. Figure is interactive; click to see another Gsdma3 mutation.

The GSDMA3 protein is a member of the gasdermin family of proteins. The Mr.Magoo mutation results in the substitution of a cysteine for a tyrosine at amino acid 344 (Y344C) of GSDMA3, in the seventh of nine conserved leucine-rich domains preceding the third coiled-coil domain (Figure 2).

See the record Michelin for more information about Gsdma3.

Putative Mechanism

Mutations in Gsdma3 have been documented to result in epithelial hyperproliferation, increased and inappropriate expression of keratins (e.g., keratin 10; see the record for Rough-fur), loss of hair follicle-associated sebaceous glands, deranged hair cycling, and hair follicle degeneration resulting in hair loss and thickened, wrinkled skin; most mutations also caused corneal opacities (1-5). Gsdma3 mutant mice generally exhibit an abnormal catagen resulting in progressive loss of hair follicles (1;2); however, one model, Rim3 (MGI:1861663; A348T), displayed an abnormal anagen phase (3). Examination of hair follicles in older mutants of several of the models determined that they were abnormally large either due to abnormal anagen or failure to regress during catagen (1;3;5). Gsdma3^Ae [Ae (alopecia & excoriation); MGI:4849547] is an ENU-induced mutation that results in the substitution of histidine for tyrosine 344 (Tyr344His) (6;7). Similar to Mr.Magoo, heterozygous Ae mice exhibit progressive hair loss from the head to the whole back and severe skin inflammation as well as severe excoriation and erosion of the dermis (6;7). Characterization of this model determined that the anchoring of the hair shaft in the hair follicle was defective, that the hair structures were abnormal, and there were reduced hair keratins (6). Li et al. propose that GSDMA3 functions upstream of, or in parallel with, the Msx2/Foxn1/acidic hair keratin cascade during hair follicle differentiation (see duke for more information about Msx2) (6).

Primers

PCR Primer
Mr_magoo_pcr_F: ACTGTGTGCCAAGTGCTAGGTTAGA
Mr_magoo_pcr_R: TCCTGGATTAAACTCAGGTCCTTGTGT

Genotyping

Mr.Magoo genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Mr.Magoo(F): 5’- ACTGTGTGCCAAGTGCTAGGTTAGA-3’

Mr.Magoo(R): 5’- TCCTGGATTAAACTCAGGTCCTTGTGT-3’

Sequencing Primer

Mr.Magoo_seq(F): 5’- CAAGTGCTAGGTTAGACCTTCAC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 619 nucleotides (from Genbank genomic region NC_000077 for linear DNA sequence of Gsdma3) is amplified:

9361                                               actgtgtgc caagtgctag

9421  gttagacctt caccgcaagt attagtcacc cagttttcct cacagcttga aggggcttta

9481  gacaagggtc agaaagtgac cctggaagca ctccccaaag atgtcctgct gtcaaaggac

9541  gctatggatg ccatcctcta cttcctcggg gctctgacag gtgagtgaga agtgagtcag

9601  acgagtttct ttctgttata agagtaaatc gtgtgaatga ttcccaaatg aatgaatgag

9661  tggattccag atggcttata tgcaatagtg tgtgtgtatg tatacatgtg tatatatata

9721  tgtacgtgta tgtatatatg tgtatgtata catatgtatg tgtatgtata tatatatatg

9781  tgtgtgtgtg tgaatatgta tgtgtatgta catataggtg tgtatgtata tatgtgtaca

9841  tatatatgtg tatgtgtgta tacatatgta tgtgtatgta tatgtgtgtg tatatatgta

9901  tgtgtatgta tatatgtata tatatacata tacgtgtgtg tgtgtgtgtg tgtgtgtgtg

9961  tgtgtgtgct ttcgtgtgtg tgtgtgtata catacacaag gacctgagtt taatccagga

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References

  1. Runkel, F., Marquardt, A., Stoeger, C., Kochmann, E., Simon, D., Kohnke, B., Korthaus, D., Wattler, F., Fuchs, H., Hrabe de Angelis, M., Stumm, G., Nehls, M., Wattler, S., Franz, T., and Augustin, M. (2004) The Dominant Alopecia Phenotypes Bareskin, Rex-Denuded, and Reduced Coat 2 are Caused by Mutations in Gasdermin 3. Genomics. 84, 824-835.

  2. Lunny, D. P., Weed, E., Nolan, P. M., Marquardt, A., Augustin, M., and Porter, R. M. (2005) Mutations in Gasdermin 3 Cause Aberrant Differentiation of the Hair Follicle and Sebaceous Gland. J Invest Dermatol. 124, 615-621.

  3. Tanaka, S., Tamura, M., Aoki, A., Fujii, T., Komiyama, H., Sagai, T., and Shiroishi, T. (2007) A New Gsdma3 Mutation Affecting Anagen Phase of First Hair Cycle. Biochem Biophys Res Commun. 359, 902-907.

  4. Sato, H., Koide, T., Masuya, H., Wakana, S., Sagai, T., Umezawa, A., Ishiguro, S., Tamai, M., and Shiroishi, T. (1998) A New Mutation Rim3 Resembling Re(Den) is Mapped Close to Retinoic Acid Receptor Alpha (Rara) Gene on Mouse Chromosome 11. Mamm Genome. 9, 20-25.

  5. Porter, R. M., Jahoda, C. A., Lunny, D. P., Henderson, G., Ross, J., McLean, W. H., Whittock, N. V., Wilson, N. J., Reichelt, J., Magin, T. M., and Lane, E. B. (2002) Defolliculated (Dfl): A Dominant Mouse Mutation Leading to Poor Sebaceous Gland Differentiation and Total Elimination of Pelage Follicles. J Invest Dermatol. 119, 32-37.

  6. Li, J., Zhou, Y., Yang, T., Wang, N., Lian, X., and Yang, L. (2010) Gsdma3 is Required for Hair Follicle Differentiation in Mice. Biochem Biophys Res Commun. 403, 18-23.

  7. Zhou, Y., Jiang, X., Gu, P., Chen, W., Zeng, X., and Gao, X. (2012) Gsdma3 Mutation Causes Bulge Stem Cell Depletion and Alopecia Mediated by Skin Inflammation. Am J Pathol. 180, 763-774.