Phenotypic Mutation 'dee_dee' (pdf version)
List |< first << previous [record 24 of 132] next >> last >|
Alleledee_dee
Mutation Type nonsense
Chromosome10
Coordinate60,308,056 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Cdh23
Gene Name cadherin 23 (otocadherin)
Synonym(s) nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
Chromosomal Location 60,302,748-60,696,490 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023370.3; NM_001252635.1ENSMUST00000105461; MGI:1890219

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000072973] [ENSMUSP00000101101] [ENSMUSP00000101102] [ENSMUSP00000101103] [ENSMUSP00000101104]
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: Y2922*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: Y2923*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: Y2925*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: Y2923*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: Y2921*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 11138008 11322776
Penetrance  
Alleles Listed at MGI

All alleles(29) : Targeted(5) Gene trapped(2) Spontaneous(12) Chemically induced(7) QTL(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
hersey UTSW 10 60308036 missense
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 036997-MU
Last Updated 2018-10-11 12:30 PM by Diantha La Vine
Record Created 2013-04-11 6:07 PM by Adam Dismang
Record Posted 2014-03-28
Phenotypic Description

The dee dee mutation was induced by N-ethyl-N-nitrosourea (ENU) mutagenesis and was discovered in G3 animals. Homozygous mutant mice exhibit excessive head bobbing.

Nature of Mutation

The mice in the dee_dee pedigree were genotyped and the causative mutation for the head bobbing phenotype was mapped using quickmapping. Among six mice with the dee dee phenotype, five were homozygous and one was heterozygous for a mutation in Cdh23 on chromosome 10.  Among 19 unaffected mice, all were either heterozygous or wild type at the Cdh23 locus, resulting in a LOD score of 5.618 for the Cdh23 mutation. The mutation is a C to A transversion at base pair 60308056 (v38) on Chromosome 10, equivalent to base pair 388435 in the GenBank genomic region NC_000076 encoding Cdh23. The mutation corresponds to residue 9176 in the NM_023370.3 mRNA sequence in exon 62 of 71 total exons. The mutation also corresponds to residue 9710 in the NM_001252635 mRNA sequence in exon 61 of 70 total exons.

 

388418 GACCTCTTCATGGCCTACAGCCCTGGCTATTTT

2918   -D--L--F--M--A--Y--S--P--G--Y--F- (ENSMUSP00000101101NP_075859.2; Cdh23(+68)) 

2916   -D--L--F--M--A--Y--S--P--G--Y--F- (ENSMUSP00000101104NP_001239564.1; Cdh23(-68))

678        -D--L--F--M--A--Y--S--P--G--Y--F- (AAT72163; Cdh23-B1) & (AAT72164; Cdh23-B2) 

 

The genomic DNA sequence is shown; numbering corresponds to NC_000076. The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to premature stop codon (*) substitution at amino acid residue 2923 in ENSMUSP00000101101 or residue 2921 in ENSMUSP00000101104.

Protein Prediction

Figure 1. Domain structures of Cdh23 splice variants. Cdh23 consists of 27 extracellular cadherin (EC) repeats, one transmembrane domain and a cytoplasmic domain that contains two PDZ-binding interfaces (PBIs; dark blue boxes). (A) Full-length Cdh23 undergoes alternative splicing that involves the inclusion or exclusion of exon 68; exon 68 encodes 35 cytoplasmic amino acids that interrupt the internal PBI of Cdh23. The B isoform proteins differ from full-length Cdh23 in that they have seven EC motifs, a transmembrane domain, and a cytoplasmic domain with (B1) or without (B2) the amino acid sequence encoded by exon 68. The C isoforms are cytosolic and do not have any EC repeats or the transmembrane domain; C1 (AAT72159) and C2 (AAT72160) both have a novel seven base pair exonic sequence, 65a, that encodes the N-terminus. C1 has exon 68, while C2 does not. The red boxes in each isoform denote the portion of the protein encoded by exon 68. The dee dee mutation results in a tyrosine to premature stop codon substitution at amino acid residue 2923 in Cdh23(+68) and 2921 in Cdh23(-68). The mutation is predicted to affect the A and B Cdh23 isoforms. SP, signal peptide; EC, extracellular cadherin repeats; TM, transmembrane domain; PBI, PDZ-binding interfaces.

Figure 2. Crystal structure of the Cdh23 (amber) and Pcdh15 (violet) heterodimer. The EC1 and EC2 domains from Cdh23 and Pch15 form an overlapped, antiparallel heterodimer. Two heterodimers are shown to represent the junction of a Pcdh15 parallel dimer interacting with a Cdh23 parallel dimer within the tip link. The calcium binding sites are stick representations in light purple.The image is based on PDB: 4AQ8 and images found within (12). The image was generated using UCSF Chimera software and is interactive; click to rotate.

Cdh23 (alternatively, Ush1d) encodes cadherin 23 (Cdh23), a member of the cadherin superfamily of cell-cell adhesion proteins (1). The cadherin proteins share similar features including a signal peptide (amino acids (aa) 1-23 in Cdh23), an extracellular domain (aa 24-3064 in Cdh23) with a variable number of extracellular ectodomain (EC) repeats (alternatively, cadherin motifs; Cdh23 has 27 EC repeats), a single helical transmembrane domain (aa 3065-3085 in Cdh23), and a cytoplasmic C-terminus (aa 3086-3354 in Cdh23) that connects the cadherin protein to the actin cytoskeleton through interactions with α- and β-catenin (Figure 1(1-4)). 

 

The EC repeats of Cdh23 are each approximately 108 aa long and are 41%-57% similar to the ectodomains of other cadherins (e.g., Cdh1, 33-44%; Cdh2, 37-41%) (5). Similar to other members of the cadherin family (6), each Cdh23 EC repeat has four calcium binding motifs that together bind three calcium ions.  Calcium binding facilitates linearization and rigidification of the cadherin ectodomain, prevents ectodomain unfolding, and promotes cadherin dimerization and consequent cell-cell adhesion (5;7;8). The overall 3D structure of the cadherin repeat motif is quite similar to the Greek-key topology of immunoglobulin domains with seven β-strands arranged as two opposing β-sheets with N- and C-termini at the opposite ends (2;7). Cdh23 forms homodimers and heterodimers with protocadherin 15 (Pcdh15; see the record for squirm) through interactions along the full length of the extracellular domain (9;10). Cdh23 interacts with Pcdh15 to form tip links, extracellular filaments that connect the tips of hair cell stereocilia and function in the gating of the hair cell’s mechanotransducer channel (see “Background” for more details; (8;9;11;12)). A crystal structure of EC1 and EC2 from mouse Cdh23 and EC1 and EC2 from mouse Pcdh15 determined that Cdh23 and Pcdh15 form an overlapped, antiparallel heterodimer through two main sites of interaction [Figure 2; PDB: 4AQ8; (10)]. The first is Leu145 and Gln187 in Cdh23 with Tyr8, Pro19, and Ile108 in Pcdh15 and the second involves Tyr16 and Gln98 of Cdh23 with Ile122, Arg113, and Val115 in Pcdh15 (10).

 

Cdh23 forms a complex with several proteins to gate the mechanoelectrical transduction channel, to form the stereocilia bundle, and to maintain the tip link in hair cells [Table 1; (13-15)]. Within the cytoplasmic domain of Cdh23 are two PDZ-binding interfaces (PBIs) that interact with PDZ domains of other proteins. For example, the internal PBI (aa 3177-3270) of Cdh23 interacts with PDZ1 of harmonin, while the C-terminal PBI of Cdh23 (aa 3351-3354) interacts with PDZ2 of harmonin as well as with MAGI-1 (16;17).  

 

Table 1. Cdh23-interacting proteins

Interacting protein (synonym)

Brief Description

Cdh23-associated function

Refs

Pcdh15 (USH1F)

See the record for squirm

Pcdh15 homodimers interact with Cdh23 homodimers (alternatively, Cdh23 and Pcdh15 form a heterodimer) to form tip links, which gate the mechanoelectrical transduction channel of hair cells

(9)

Harmonin (USH1C)

Scaffold protein

Harmonin binds to Cdh23, Pcdh15, and F-actin to achor the interstereocilia links to the stereocilia actin core

(13;16;18;19)

Myo7a (USH1B)

Actin-based molecular motor

Interacts with Cdh23 and harmonin to facilitate the cohesion of the stereocilia

(18;20;21)

Myo1c

Actin-based molecular motor

Forms a complex with Cdh23 in the mechanotransduction apparatus

(22)

MAGI-1

Scaffold protein

Interacts with Cdh23 beneath the stereociliary plasma membrane to connect the cytoskeleton with the Cdh23-harmonin-Myo7a complex

(17)

SANS (USH1G)

Scaffold protein

Interacts with Cdh23, Myo7a and harmonin complex to maintain the tip link

(23;24)

EHD4

Endocytic recycling

May regulate calcium-sensitive Cdh23 trafficking/localization in cochlear hair cells

(25)

 

Please see the record for squirm for more information about the cadherin proteins.

 

Alternative splicing of Cdh23 in both mice and humans involves the inclusion [Cdh23(+68)] or exclusion [Cdh23(-68)] of exon 68, which encodes 35 cytoplasmic amino acids that when present, interrupt the internal PBI of Cdh23 (3-5;16;26).  Harmonin binding to the hair cell-specific Cdh23(+68) isoform is reduced compared to binding to the Cdh23(-68) isoform, which is prevalent in the retina (16). Lagziel et al. described the identification of two Cdh23 isoforms (B1 and B2) of differing lengths (3787 bp (AY563163) and 3682 bp (AY563164) in mouse, respectively; 4044 bp and 3939 bp in human, respectively) (Figure 1(26)). The B isoforms are predicted to encode proteins with seven EC motifs, a single transmembrane domain, and a cytoplasmic domain with (B1) or without (B2) the amino acid sequence encoded by exon 68 (26). Two additional isoforms were identified and are 1783 bp (C1; exons 66-69) and 1678 bp (C2; exons 66, 67, and 69) in humans (26). In mice, the C1 and C2 isoforms are encoded by the corresponding exons and are 1172 bp (AY563159) and 1064 bp (AY563160), respectively. The C1 and C2 isoforms encode the cytoplasmic domain of Cdh23 and do not have transmembrane domains, EC repeats, or a signal peptide; C1 and C2 are expected to be cytosolic (13;26).  The mouse and human C isoforms have a novel exonic sequence, 65a, encoding the seven N-terminal amino acids of these proteins (MLLPNYR) (26). Exon 65a is located immediately upstream of the 5’ boundary of exon 66 in full-length Cdh23 (13;26).  Michel et al. propose that the C1 and C2 isoforms mediate the interaction of the transmembrane forms of Cdh23 with cytosolic binding partners (13).

 

The dee dee mutation encodes a premature stop codon within EC27. The mutation is predicted to affect all of the Cdh23 isoforms with the exception of C1 and C2, although expression of the Cdh23 isoforms has not been examined.

Expression/Localization

Reverse-transcriptase (RT)-PCR detected Cdh23 in several adult tissues in the mouse including brain, heart, kidney, liver, spleen, ear, skeletal muscle, eye, thymus, lung, and testis (1;27).  In the mouse embryo, Cdh23 is expressed as early as embryonic day (E) 7 (27). At E18, in situ hybridization detected high Cdh23 expression in the components of the vestibular system (i.e., semicircular canals, saccule, utricle, and cochlea of the inner ear) that maintains balance and equilibrium (27).  Within the mouse inner ear, Cdh23 is highly expressed in sensory hair cells and Reissner’s membrane (27).  At postnatal day (P)7, P9, and P12, Cdh23 protein expression was detected in the cochlea and vestibule in the inner ear as well as in the eye, brain and testis of the mouse (28).  In hair cells of the inner ear, Cdh23 is localized to the centrosome, transient lateral links, tip links, and kinociliary links that link the kinocilium (the genuine cilium in the immature hair bundle) to the adjacent stereocilia; Cdh23 is also detected in Reissner’s membrane (1;3;9;13;16;18;25;26). Upon hair cell maturation, Cdh23 becomes restricted to the distal tip of the hair bundle (13).

 

Northern blot of human RNA detected CDH23 in the retina; expression was not detected in the ciliary body, retinal pigmented epithelium (RPE)-choroid, lens, iris, brain, heart, placenta, lung, liver, skeletal muscle, or kidney (3). No explanation was offered for the differences observed between the expression pattern of mouse and human Cdh23.  Northern blot of macula and peripheral retina total RNA from monkey detected Cdh23 RNA in both retinal regions (3). Within the retina, Cdh23 is localized to both rod and cone photoreceptors in the inner segment, the connecting cilium, the basal body complex, and the ribbon synapses; Cdh23 is not expressed in the RPE [(29); reviewed in (30)].

 

Apostolopoulou et al. propose that Cdh23 is upregulated in human breast cancer (31). Cdh23 is localized to homotypic adhesions between MCF-7 cells (a breast cancer epithelial cell line) as well as to heterotypic contacts between MCF-7 cells and normal breast fibroblasts (NBFs) after co-culture of MCF-7 cells and NBFs (31). In NBF cells, Cdh23 is also localized to centrosomes (31). In tumor and healthy breast tissue samples, Cdh23 is more highly expressed in luminal epithelia than in stroma (31).

 

Cdh23(+68) is the exclusive isoform expressed by hair cells and is predominantly (if not exclusively) expressed in organ of Corti within the inner ear of the mouse (5;16;22). Cdh23(-68) is expressed in the cochlea and vestibule of the inner ear as well as in the eye, brain and testis of the mouse (28).  Both the transmembrane (B1 and B2) and cytosolic (C1 and C2) forms of Cdh23 are expressed in the cochlea; additional expression analysis on these isoforms has not been documented (13).  The cytosolic isoforms are localized to the centrosome (13;26).

Background

Figure 3. Sensory cells in the inner ear and retina. (A) Inner hair cells are located within the organ of Corti. The hair bundle is composed of numerous stereocilia that develop from microvilli and have a stiff core of parallel actin filaments anchored in the cuticular plate, a meshwork of horizontal actin filaments beneath the apical cell membrane. Lateral to the tallest stereocilium is the kinocilium, which is formed from the basal body. The stereocilia are connected to each other by numerous filaments, including tip links, horizontal top connectors, transient lateral links and ankle links. The synaptic junction between the hair cell and afferent and efferent neurons is located at the base of the cell and contains ribbons. (B) The molecular components of the cross link complexes of the inner ear hair cell. In the tip link, cadherin23 interacts with protocadherin15, harmonin, Myo7a, Myo1c, calmodulin, and Sans to help maintain the structure and function of the inner ear hair cell. (C) Rod and cone cells are highly polarized photoreceptors. The outer segment is a modified cilium and is attached to the inner segment by a connecting cilium. The nucleus is located within the outer nuclear layer. The synaptic terminals contain ribbons and connect the photoreceptor cells with horizontal, ganglion, and bipolar (shown) cells.

Cell-cell adhesive connections mediated by cadherins function in diverse processes including cell sorting, synapse formation, the development and function of sensory cells in the inner ear and retina, and cell migration during development and in the adult [Figure 3; (32); reviewed in (33)].

 

At their apical surface, hair cells in the cochlea of the inner ear have a single kinocilium and a bundle of actin-filled stereocilia arranged in a staircase of increasing height (18;34;35). Each stereocilium is connected to its taller neighbor by the tip link (36); side links, ankle links, and horizontal top connectors also connect the individual stereocilia and coordinate their movement (33;37). During deflection of the hair bundle, the tip link translates the mechanical forces arising from sound waves and head movement into electrochemical signals through gating of the mechanoelectric transducer channels at the lower end of each tip link (17;34;37); these electrical signals facilitate hearing and balance (8). Cdh23 interacts with Pcdh15 to form the tip link (5;28;38).  

 

In the synaptic terminals of the photoreceptor cells of the retina, Cdh23 colocalizes with Pcdh15, harmonin, and Myo7a. The complex in the photoreceptor synapse is proposed to have a role in the structural and functional organization of the synaptic junction (39).  See the record squirm for more information about the sensory cells in the inner ear and retina as well as the known functions of Cdh23, Pcdh15, and the Usher syndrome-associated proteins therein.

 

In humans, missense mutations in CDH23 are typically linked to autosomal recessive deafness 12 [DFNB12; OMIM: #601386; (3;40)], while null mutations are typically linked to Usher syndrome type 1D (USH1D) and Usher syndrome type 1D/F digenic [OMIM: #601067; (3;4)].  DFNB12 is a form of nonsyndromic autosomal recessive deafness. The phenotype in patients with DFNB12 can also include moderate to profound high-frequency progressive sensorineural hearing loss; vestibular and retinal function are normal in patients with DFNB12 (40). USH1D is characterized by hearing loss, retinitis pigmentosa leading to blindness, and in some cases, vestibular dysfunction (15;18;38). Type 1D/F Usher syndrome is caused by heterozygous mutations in both CDH23 and PCDH15. Patients with Usher syndrome type 1D/F exhibit congenital nonprogressive deafness, vestibular dysfunction, and retinitis pigmentosa (41).

 

Several Cdh23 mutant mouse alleles have been reported and all (with the exception of Cdh23v-bus (MGI:1856681), a donor splice site mutation after exon 67 in Cdh23) are within or affect an EC domain (1;5;21;27;38;42-45). Similar to the mutations found in humans, nonsense and splice-site mutations that lead to Cdh23 null alleles result in USHD1 phenotypes, while missense mutations result in phenotypes characteristic of DFNB12 [reviewed in (38)]. The null mutations [e.g., waltzer (Cdh23v; MGI:1856228)] affect hair bundle development and cause defects in the organization of the stereocilial bundle in the cochlear hair cells and misplaced kinocilia (1;44;46). These defects lead to both hearing loss and vestibular defects (as exhibited by circling, head tilt, and/or head tossing) (1;43;44). In contrast, the hair cells and hair bundles develop normally in mouse mutants with missense mutations of Cdh23, but the function is affected (21). Although all of the mouse models exhibit hearing loss; retinal degeneration does not occur (38). Examination of three Cdh23 null mutants using electroretinography determined that two out of the three mutants exhibited abnormal retinal function; cone photoreceptor function was mildly attenuated as well as the response of retinal interneurons (15). However, histological examination determined that the anatomy of the retinas were normal (15). Libby et al. propose that the difference between the mouse and human retina phenotypes in null mutants is dependent on genetic background (15). It is possible that in other genetic backgrounds that have yet to be tested, Cdh23 null alleles may exhibit retinal degeneration.

 

Cdh23 mutations in mice can also cause noise-induced and age-related hearing loss. Mice heterozygous for a Cdh23 null mutation (Cdh23v) are predisposed to noise-induced hearing loss (47).  Sequence analysis of the CBA/CaJ strain (a strain with normal hearing throughout life) and the C57BL/6J strain (a strain that develops age-related hearing loss), as well as 54 additional inbred strains, determined that a single-nucleotide polymorphism, Cdh23G753A, showed significant association with age-related hearing loss (42).

 

An ENU-induced mouse Cdh23 allele, salsa (MGI:3708379), causes progressive hearing loss due to a missense mutation predicted to affect calcium binding by the extracellular domain (21).  These mice do not have hair bundle development defects or vestibular dysfunction, however, tip links are progressively lost, subsequently leading to hair cell death (21).  The salsa mutation alters the interaction of Cdh23 with Pcdh15 (21).  Another ENU-induced allele, erlong (MGI:4453135), contains a recessive missense mutation that leads to progressive hearing loss with no vestibular abnormalities (45).  The jera model (MGI: 5140884) harbors an ENU-induced missense Cdh23 mutation that causes more severe hearing loss than that observed in salsa and erlong mice; the development of hair bundles appears normal in jera (38). The jera mouse is also susceptible to noise-induced hearing loss (38)

Putative Mechanism

The dee dee mice exhibit vestibular dysfunction similar to waltzer and other Cdh23 null mouse models. Another spontaneous premature stop codon twelve amino acids away from the dee dee mutation occurs at residue 2935 (Arg2935*) in the mouse model Cdh23V-5J (MGI:1857520). Homozygous Cdh23V-5J mice exhibit head bobbing and circling and are deaf.  Dee dee mice have not been examined for deafness, but share the other Cdh23V-5J and waltzer phenotypes, indicating that dee dee is probably a null mutation that results in alterations in the organization of the stereocilia bundle in hair cells of the cochlea and the vestibule as well as misplaced kinocilia.

Primers PCR Primer
dee_dee(F):5'- AGGCGAATGAACTCCTCCTCGAAG -3'
dee_dee(R):5'- GCAGTGTTTACATAAAGCTGGAGCAAC -3'

Sequencing Primer
dee_dee_seq(F):5'- TCCTCCTCGAAGCCACG -3'
dee_dee_seq(R):5'- TGGAGCAACCACTAAAAATCAGG -3'
Genotyping

Dee dee genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

 

PCR Primers

DeeDee(F): 5’-GCAGTGTTTACATAAAGCTGGAGCAAC- 3’

DeeDee(R): 5’- AGGCGAATGAACTCCTCCTCGAAG- 3’

 

Sequencing Primer

DeeDee_seq(R): 5’- TCCTCCTCGAAGCCACG- 3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 409 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Cdh23) is amplified:

 

388191                                                        gcagtgttta

388201 cataaagctg gagcaaccac taaaaatcag gagcgtttca gccaggcatg ctagcgtatg

388261 cctataatcc cagcactcag gctgtggacg tggagaactc tgacttcctc caaggatgtg

388321 gcttaggggg cagggcttat catcagtatg tgtggcctct gagctgtgcc accccgactc

388381 tttaacaggg agtgtggacg gtatcctgcg cacctttgac ctcttcatgg cctacagccc

388441 tggctatttt gtggtagaca tcgtggcccg agacctggcc ggccacaatg ataccgccat

388501 catcggcatc tacatcctga gggatgacca gcgcgtgaag atcgtcatca atgagatccc

388561 ggaccgcgtg cgtggcttcg aggaggagtt cattcgcct

 

Sense strand shown. Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (C>A, sense strand; G>T, Chr. + strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsAdam Dismang, Tiana Purrington, and Bruce Beutler
List |< first << previous [record 24 of 132] next >> last >|