Phenotypic Mutation 'Lps2'

• Allele: Lps2
• Mutation Type: frame shift
• Chromosome: 17
• Coordinate: 56,269,969 bp (GRCm38)
• Base Change: TC ⇒ T (forward strand)
• Gene: Ticam1
• Gene Name: toll-like receptor adaptor molecule 1
• Synonym(s): TICAM-1, Trif
• Chromosomal Location: 56,269,319-56,276,786 bp (-)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012] ; PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q80UF7
• SMART Domains: Protein: ENSMUSP00000055104; Gene: ENSMUSG00000047123; AA Change: 708

Domain	Start	End	E-Value	Type
PDB:4BSX|D	5	153	3e-52	PDB
low complexity region	345	384	N/A	INTRINSIC
SCOP:d1fyva_	386	491	8e-3	SMART
PDB:2M1X|A	391	547	1e-74	PDB
Pfam:RHIM	610	698	4.7e-13	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice, Embryos, Sperm, gDNA
• Last Updated: 2022-07-05 10:45 PM
• Record Created: unknown
• Record Posted: 2007-10-29
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Kasper Hoebe, Bruce Beutler

Accession Number

NCBI RefSeq: NM_174989; MGI: 2147032

Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(2) Chemically induced(1)

Repository

JAX: 005037 (C57BL/6-Ticam1^Lps2)

Phenotypic Description

Figure 1. (a-g) TNF responses of Lps2 macrophages to various TLR ligands. Both Lps2 heterozygous and homozygous macrophages show decreased responses to the TLR4 ligands Lipid A (a) and LPS (b), the TLR3 ligand poly(I:C), but normal responses to the TLR2 ligand Pam 3 CSK 4 (d), the TLR7 ligand resiquimod (e), the TLR9 ligand CpG DNA (f), and the TLR2/6 ligand peptidoglycan (g). LPS-induced cytotoxicity is shown in (h). Values represent means s.e.m. (n=6 mice). Figure reproduced from reference ( 2 ).

Lps2 was the first immunological phenotype identified in an ENU-induced mutagenesis screen designed to detect aberrant cytokine responses to Toll-like receptor (TLR) agonists (TLR Signaling Screen) (1;2).  Peritoneal macrophages isolated from the mutant showed markedly diminished tumor necrosis factor (TNF)-α production in response to lipopolysaccharide (LPS) and lipid A, which signal via TLR4, and poly I:C (a dsRNA mimetic), which signals through TLR3. In contrast, stimulation with Pam₃CSK₄ (triacyl lipopeptide), peptidoglycan, resiquimod (a ssRNA mimetic) and unmethylated CpG oligodeoxynucleotides (CpG ODN) resulted in normal TNF-α production, indicating that signaling via TLRs 1, 2, 6, 7, and 9 was not affected by the Lps2 mutation. Similarly, signaling through TLR2/6 heterodimers, using zymosan as an inducer, was normal. In addition, LPS-induced macrophage toxicity was abrogated in the mutant. Heterozygous Lps2 mice displayed partially defective responses to LPS, lipid A and poly I:C, indicating that the mutant allele is semidominant, or that the wild type allele is haploinsufficient (Figure 1).

Homozygous Lps2 mutants are hypersusceptible to infection with mouse cytomegalovirus (MCMV), as demonstrated by the following: 1) they display a 1000-fold higher splenic viral titer than wild type mice after intraperitoneal inoculation, 2) they succumb to MCMV infection over a range of inocula that do not kill wild type mice, and 3) they fail to produce type 1 interferon (IFN) after infection (MCMV Susceptibility and Resistance Screen).

 

The Lps2 mutation also affects the adjuvanticity of LPS (3). Lps2 macrophages fail to upregulate the costimulatory molecules CD40, CD80, and CD86, as well as major histocompatibility complex (MHC) class II molecules in response to LPS. Upon intraperitoneal immunization with two immunodominant OVA peptides along with LPS as an adjuvant, proliferation of antigen-specific CD4⁺ T cells or expansion of antigen-specific effector CD8⁺ T cellsdoes not occur in Lps2 homozygotes. Surprisingly, Lps2 mice still upregulate costimulatory molecules induced by poly I:C (as do Tlr3^-/- mutants). It is now known that the IFN-inducible protein mda-5 (melanoma differentiation-associated gene 5) is able to detect poly I:C, and presumably, is an alternative receptor capable of mediating adjuvant effects (4).

Nature of Mutation

The Lps2 mutation was mapped to Chromosome 17, and corresponds to a single nucleotide deletion of a G at position 2258 (in exon 2 of 2 total exons), causing a frameshift which deletes 24 amino acids from the C-terminus of the protein and replaces them with 11 unrelated amino acids followed by a premature stop.

 

2241 CAGTCATCTGATGACAAGACTGAGTGTTCGGAGAACCCCTGTATGGGCCCTCTGA

703  -Q--S--S--D--D--K- -L--S--V--R--R--T--P--V--W--A--L--*

          correct                   aberrant

 

The deleted G is indicated in red lettering within the cDNA sequence (Genbank Accession NM_174989). The aberrant amino acids encoded by the frame-shifted DNA sequence are shown.

Protein Prediction

Figure 2. TICAM-1 (alternatively, TRIF) is a 732-amino acid protein that contains an N- and C-terminal proline-rich domain (PR).  TRIF contains a 200 amino acid Toll/IL-1 receptor (TIR) domain. TRIF has three TRAF6 binding motifs at the N-terminus. The Lps2 mutation alters 24 C-terminal amino acids that may subsuently destabilize or inactivate the mutant protein (pink box). Locations of domains/motifs are from Uniprot: Q80UF7. Click on the image to view other mutations found in TICAM-1. Click on each mututation for more specific information.

Ticam1 encodes the 732-amino acid protein TICAM-1 [Toll-interleukin 1 receptor (TIR) domain-containing adaptor molecule-1; hereafter TRIF (TIR domain-containing adaptor inducing IFN-β)], an adaptor in TLR3 and TLR4 signaling (Figure 2). In human TRIF, the N- and C-termini contain proline-rich domains (5); only the C-terminal proline-rich domain is conserved in mouse Trif (6). TRIF also contains a Toll/IL-1 receptor (TIR) domain, a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction (5;7). TIR domains in TLRs, IL receptors and the adaptors MyD88 and TIRAP contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (8). However, conserved sequences in boxes 1, 2 and 3 are lacking in Trif. Specifically, the (F/Y)D in box 1, RD in box 2 and FW in box 3 are missing in Trif (5). TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops. The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (9). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4, which abolishes MyD88 binding (10) and LPS-induced signaling in mice (11). This proline residue is conserved in Trif. Trif differs from MyD88 in that it lacks a death domain (5;7), which in MyD88 recruits IL-1 receptor associated kinase (IRAK) family proteins (12). Trif reportedly harbors between one and three TNF receptor-associated factor-6 (TRAF6) binding motifs at its N-terminus (13;14), defined by the sequence P-X-E-X-X-acidic/aromatic (15). When co-transfected into HEK 293 cells, TRIF and TRAF6 can be co-immunoprecipitated (13;14). Mutant TRIF constructs in which E252 or all three glutamate residues in the putative TRAF6 binding motifs are mutated to alanine cannot be co-immunoprecipitated with TRAF6, and fail to activate an NF-κB luciferase reporter (13;14). However, recent data obtained using TRAF6^-/- macrophages demonstrate that TRAF6 is not required for TRIF-dependent NF-κB activation (16), suggesting that the TRIF-TRAF6 interaction has a separate, yet unknown function, or that in TRAF6^-/- cells another protein can fulfill this role.

 

The Lps2 mutation replaces the C-terminal 24 amino acids of Trif with 11 improper amino acids. It has been noted that the 19 C-terminal residues of mouse Trif are not represented in the human homologue, although the human protein is functional in when transfected into cells (2). The addition of 11 aberrant amino acids may destabilize or inactivate the mutant protein (2).

Expression/Localization

Northern blot analysis of human tissues revealed that Trif is expressed ubiquitously (5;7). Among immune cells, Trif is expressed in immature dendritic cells (iDC), macrophages and natural killer (NK) cells (5). Trif is localized in the cytoplasm (17).

 

Background

TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses. The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adaptor proteins known to date: MyD88, Tirap (Mal), TICAM-1 (TRIF) and TRAM (18). TLR signaling through these adaptors initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7.

 

Although MyD88 is common to signaling pathways activated by almost all the TLRs, the existence of a MyD88-independent pathway was evidenced by the intact (but slightly delayed) LPS-dependent activation of NF-κB, JNK and MAP kinases in MyD88-deficient macrophages (19). MyD88-deficient dendritic cells (DC) can also activate NF-κB and MAP kinase (20); this leads to functional maturation of MyD88-deficient DCs as shown by upregulation of costimulatory molecules and enhancement of APC activity (3;21). Furthermore, the MyD88-independent pathway was demonstrated to stimulate phosphorylation and nuclear translocation of IRF-3, IRF-3 binding to interferon-stimulated response elements (ISRE), and transcription of interferon-inducible genes (20;22). These findings prompted the search for TIR domain-containing adaptors that could mediate such MyD88-independent TLR signaling.

 

Initially, the MyD88-independent pathway was attributed to Tirap (23;24). However, subsequent study of Tirap-deficient mice demonstrated that their macrophages display the same intact but delayed LPS-dependent activation of NF-κB, JNK and MAP kinases observed in MyD88-deficient macrophages (25;26). In addition, expression of interferon-inducible genes and DC maturation is still observed in Tirap-null and MyD88^-/-Tirap^-/- double knockout mice (26). Together, these data indicate that Tirap does not mediate MyD88-independent TLR4 signaling, but that Tirap functions with or in parallel to MyD88. Tirap has been shown to form heterodimers with MyD88, in agreement with this possibility (24).

 

Trif was first identified using a sequence homology search for other TIR domain-containing adaptors (7), and by yeast two-hybrid screening using the intracellular domain of TLR3 as bait (5). Trif activates transcription of a reporter controlled by the IFN-β or NF-κB promoters in transfected HEK 293 cells (5;7). However, it was unclear whether Trif served as an adaptor for all TLRs (7) or only for TLR3 (5).

Putative Mechanism

Study of the Lps2 strain, and subsequently of Trif^-/- mice, demonstrated that primarily two adaptors, Trif and MyD88, act in LPS-induced TLR4 signaling leading to NF-κB and IRF-3 activation, and upregulation of costimulatory molecules (2;3;27). While Lps2 and Trif^-/- cells can activate JNK, MAP and NF-κB, double mutant Trif^Lps2/Lps2My88^-/- or Trif^-/-MyD88^-/- cells display no JNK, MAP or NF-κB activation (2;27). Thus, both Trif and MyD88 can activate NF-κB independently, and deficiency of both proteins is necessary to abrogate this response. [Compound Trif^Lps2/Lps2My88^-/- mutants show no response to any TLR ligands except dsRNA (2;27;28).] IRF-3 activation requires Trif alone, not MyD88, as evidenced by the failure of Lps2 or Trif^-/- cells to activate interferon-inducible genes in response to LPS (2;27), while MyD88-null cells do so normally (19;22). Upregulation of costimulatory molecules has also been attributed to Trif, since Lps2 macrophages do not upregulate costimulatory molecules CD40, CD80 or CD86 in response to LPS, although MyD88-deficient cells do so normally (3).

 

Figure 3. TICAM signaling pathways. In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM recruits polyubiquitinated RIP2, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN produciton through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKε; RIP1 is not required for TICAM-dependent activation of IRF3. Internalized TLR4 in late endosomes signals through the TICAM-dependent pathway. While on the cell surface, TLR4 can signal through TRAM to induce IRF7 activation in reponse to vesicular stomatitis virus glycoprotein G (VSV-G). This process is partially dependent on TICAM.

It is now understood that the MyD88-dependent pathway induces an early-phase activation of NF-κB and MAP kinases, while the Trif-mediated MyD88-independent pathway induces a late-phase activation of NF-κB and MAP kinases (Figure 3). This implied that the MyD88 and Trif pathways converged at some point distal to MyD88 and Trif, but proximal to NF-κB activation. Initial studies provided evidence that Trif binds to TRAF6 (13;14), an E3 ubiquitin ligase that also coordinates the activation of several kinases including TAK-1, and in turn MAP kinases and the IKK complex leading to NF-κB activation. It had been thought that all TLR pathways are mediated by TRAF6, including the TRIF-dependent activation of NF-κB. However, recent studies showed that the LPS-stimulated induction of NF-κB in TRAF6^-/- cells follows the delayed kinetics observed in MyD88-deficient cells (16). In addition, expression of the interferon-inducible gene IP10 and upregulation of the costimulatory molecule CD86 occurs normally in response to LPS in TRAF6^-/- macrophages (16). Thus, TRAF6 is not required for TLR4, Trif-dependent signaling, and the convergence of the MyD88-dependent and –independent pathways must lie downstream of TRAF6.

 

Despite the integrity of the pathway from TLR4 to NF-κB and MAP kinase activation in MyD88- and Trif-deficient mutants, LPS-induced responses clearly require both adaptors for optimal function. Although deficiencies in both MyD88 and Trif are required to completely abrogate LPS-induced JNK, MAP and NF-κB activation, LPS-induced cytokine production is nearly abolished in Trif mutants (2;27;28), and Lps2 mice are hypersusceptible to MCMV infection (2).

 

In addition to Trif, the protein TRAM (TRIF-related adaptor molecule) also serves as an adaptor in MyD88-independent TLR4 signaling stimulated by LPS (2;29). Its existence was postulated when a population of homozygous Lps2 macrophages was observed to produce low levels of TNF-α in response to LPS, but not poly I:C (2). Originally called “adaptor X” and hypothesized to be a TRIF homologue on mouse Chromosome 18, it was confirmed to be the TRAM protein by targeted deletion in mice (2;29). TRAM^-/- macrophages fail to produce TNF-α and IL-6 in response to LPS, but not peptidoglycan, R-848 (TLR7 ligand), or CpG ODN (29). Both LPS- and poly I:C-stimulated NF-κB activation is normal in TRAM^-/- cells. In contrast, poly I:C, but not LPS, induces expression of IFN-inducible genes in TRAM-/- cells (29). Thus, together with TRIF, TRAM specifically mediates the MyD88-independent pathway of TLR4 signaling.

 

Trif-mutant mice also revealed that Trif is the only adaptor serving TLR3 (2;27). Lps2 or Trif-null macrophages fail to activate NF-κB or IRF-3, or induce IFN-β in response to poly I:C (2;27). TRAF6 is also not required for TLR3, Trif-dependent signaling, since poly I:C-stimulated (Trif-dependent) activation of MAP kinase, IFN promoter and TNF-α production is normal in TRAF6^-/- macrophages (16).

Primers

Primers cannot be located by automatic search.

Genotyping

Lps2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide deletion. The same primers are used for PCR amplification and for sequencing.

 

Primers

Lps2(F): 5’-ACAGTCCCAATCCTTTCCATCAGC-3’

Lps2(R): 5’-AGGATTCAGATTGGAGTCCCACAGTC-3’

 

PCR program

1) 94°C                            2:00

2) 94°C                            0:30

3) 55°C (annealing)           0:30

4) 72°C                            0:45

5) repeat steps (2-4) 34X

6) 72°C                            7:00

7) 4°C                              ∞

 

The following sequence of 476 nucleotides all within one exon (from Genbank Accession NC_000083) is amplified:

 

2111            acagtcccaa tcctttccat cagcctcctc cccagcccca cagactccag

2161 gacctcagcc tctcattatt caccatgccc agatggttca gctgggtgtc aacaatcaca

2221 tgtggggcca cacaggggcc cagtcatctg atgacaagac tgagtgttcg gagaacccct

2281 gtatgggccc tctgactgat cagggcgaac cccttcttga gactccagag tgaccaggtt

2341 ggaccccacc tagatggcta gagtgacaag attggacttc acctgggtcc ttaaaatgat

2401 agtggaggaa gggaacctcg cctgggtccc cagagtagcc agaggactta gcttgggctc

2461 cacagtggct attagttgga cccagcttga gaccccagag gcagggaaga ccacacctat

2521 aaatcaggcc tgggaaacat gcagaaaccc catttgaaca gactgtggga ctccaatctg

2581 aatcct

 

Primer binding sites are underlined; the deleted G is shown in red text.

References

   1.  Hoebe, K., Du, X., Goode, J., Mann, N., and Beutler, B. (2003) Lps2: a new locus required for responses to lipopolysaccharide, revealed by germline mutagenesis and phenotypic screening, J. Endotoxin Res. 9, 250-255.

   2.  Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S. O., Goode, J., Lin, P., Mann, N., Mudd, S., Crozat, K., Sovath, S., Han, J., and Beutler, B. (2003) Identification of Lps2 as a key transducer of MyD88-independent TIR signaling, Nature 424, 743-748.

   3.  Hoebe, K., Jannsen, E. M., Kim, S. O., Alexopoulou, L., Flavell, R. A., Han, J., and Beutler, B. (2003) Upregulation of costimulatory molecules induced by lipopolysaccharide and double-stranded RNA occurs by Trif-dependent and Trif-independent pathways., Nature Immunology 4, 1223-1229.

   4.  Gitlin, L., Barchet, W., Gilfillan, S., Cella, M., Beutler, B., Flavell, R. A., Diamond, M. S., and Colonna, M. (2006) Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus, Proc. Natl. Acad. Sci. U. S. A 103, 8459-8464.

   5.  Oshiumi, H., Matsumoto, M., Funami, K., Akazawa, T., and Seya, T. (2003) TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction, Nat. Immunol. 4, 161-171.

   6.  Seya, T., Oshiumi, H., Sasai, M., Akazawa, T., and Matsumoto, M. (2005) TICAM-1 and TICAM-2: toll-like receptor adapters that participate in induction of type 1 interferons, Int. J Biochem. Cell Biol. 37, 524-529.

   7.  Yamamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., and Akira, S. (2002) Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling, J. Immunol. 169, 6668-6672.

   8.  Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. (2000) Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J. Biol. Chem. 275, 4670-4678.

   9.  Xu, Y., Tao, X., Shen, B., Horng, T., Medzhitov, R., Manley, J. L., and Tong, L. (2000) Structural basis for signal transduction by the Toll/interleukin-1 receptor domains, Nature 408, 111-115.

 10.  Rhee, S. H. and Hwang, D. (2000) Murine TOLL-like Receptor 4 Confers Lipopolysaccharide Responsiveness as Determined by Activation of NFkappa B and Expression of the Inducible Cyclooxygenase, J. Biol. Chem. 275, 34035-34040.

 11.  Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.

 12.  Wesche, H., Henzel, W. J., Shillinglaw, W., Li, S., and Cao, Z. (1997) MyD88: an adapter that recruits IRAK to the IL-1 receptor complex, Immunity 7, 837-847.

 13.  Sato, S., Sugiyama, M., Yamamoto, M., Watanabe, Y., Kawai, T., Takeda, K., and Akira, S. (2003) Toll/IL-1 receptor domain-containing adaptor inducing IFN-beta (TRIF) associates with TNF receptor-associated factor 6 and TANK-binding kinase 1, and activates two distinct transcription factors, NF-kappa B and IFN-regulatory factor-3, in the Toll-like receptor signaling, J. Immunol. 171, 4304-4310.

 14.  Jiang, Z., Mak, T. W., Sen, G., and Li, X. (2004) Toll-like receptor 3-mediated activation of NF-kappaB and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-beta, Proc. Natl. Acad. Sci U. S. A 101, 3533-3538.

 15.  Ye, H., Arron, J. R., Lamothe, B., Cirilli, M., Kobayashi, T., Shevde, N. K., Segal, D., Dzivenu, O. K., Vologodskaia, M., Yim, M., Du, K., Singh, S., Pike, J. W., Darnay, B. G., Choi, Y., and Wu, H. (2002) Distinct molecular mechanism for initiating TRAF6 signalling, Nature 418, 443-447.

 16.  Gohda, J., Matsumura, T., and Inoue, J. (2004) Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domain-containing adaptor-inducing IFN-beta (TRIF)-dependent pathway in TLR signaling, J Immunol. 173, 2913-2917.

 17.  Akira, S. and Takeda, K. (2004) Toll-like receptor signalling, Nat. Rev. Immunol. 4, 499-511.

 18.  Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe, K. (2006) Genetic analysis of host resistance: Toll-Like receptor signaling and immunity at large, Annu. Rev. Immunol. 24, 353-389.

 19.  Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Unresponsiveness of MyD88-deficient mice to endotoxin, Immunity 11, 115-122.

 20.  Hoshino, K., Kaisho, T., Iwabe, T., Takeuchi, O., and Akira, S. (2002) Differential involvement of IFN-beta in Toll-like receptor-stimulated dendritic cell activation, Int. Immunol 14, 1225-1231.

 21.  Kaisho, T., Takeuchi, O., Kawai, T., Hoshino, K., and Akira, S. (2001) Endotoxin-induced maturation of myd88-deficient dendritic cells, J. Immunol. 166, 5688-5694.

 22.  Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and Akira, S. (2001) Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes, J. Immunol. 167, 5887-5894.

 23.  Horng, T., Barton, G. M., and Medzhitov, R. (2001) TIRAP: an adapter molecule in the Toll signaling pathway, Nat. Immunol. 2, 835-841.

 24.  Fitzgerald, K. A., Palsson-McDermott, E. M., Bowie, A. G., Jefferies, C. A., Mansell, A. S., Brady, G., Brint, E., Dunne, A., Gray, P., Harte, M. T., McMurray, D., Smith, D. E., Sims, J. E., Bird, T. A., and O'Neill, L. A. (2001) Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction, Nature 413, 78-83.

 25.  Horng, T., Barton, G. M., Flavell, R. A., and Medzhitov, R. (2002) The adaptor molecule TIRAP provides signalling specificity for Toll-like receptors, Nature 420, 329-333.

 26.  Yamamoto, M., Sato, S., Hemmi, H., Sanjo, H., Uematsu, S., Kaisho, T., Hoshino, K., Takeuchi, O., Kobayashi, M., Fujita, T., Takeda, K., and Akira, S. (2002) Essential role for TIRAP in activation of the signalling cascade shared by TLR2 and TLR4, Nature 420, 324-329.

 27.  Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003) Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway, Science 301, 640-643.

 28.  Janssen, E., Tabeta, K., Barnes, M. J., Rutschmann, S., McBride, S., Bahjat, K. S., Schoenberger, S. P., Theofilopoulos, A. N., Beutler, B., and Hoebe, K. (2006) Efficient T cell activation via a Toll-Interleukin 1 Receptor-independent pathway, Immunity 24, 787-799.

 29.  Yamamoto, M., Sato, S., Hemmi, H., Uematsu, S., Hoshino, K., Kaisho, T., Takeuchi, O., Takeda, K., and Akira, S. (2003) TRAM is specifically involved in the Toll-like receptor 4-mediated MyD88-independent signaling pathway, Nat. Immunol. 4, 1144-1150.