Allele | teeny | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | nonsense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 56,757,374 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Kbtbd2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | kelch repeat and BTB (POZ) domain containing 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Bklhd1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 56,754,510-56,774,798 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype | PHENOTYPE: Mice homozygous for a knock-out allele or mutation exhibit diabetes, lipodystrophy, and hepatic steatosis. [provided by MGI curators] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine changed to Stop codon | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000109960] [ENSMUSP00000109962] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | G3X9X1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000109960 Gene: ENSMUSG00000059486 AA Change: R121*
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000109962 Gene: ENSMUSG00000059486 AA Change: R121*
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably null | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9755 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2022-04-12 3:40 PM by External Program | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2013-05-18 10:00 AM by Jennifer Weatherly | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-10-13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The teeny phenotype was identified among G3 mice of the pedigree R0491 (1). The teeny mice exhibit decreased body sizes (Figure 1) and body weights compared to their wild-type littermates (Figure 2). The teeny mice also showed increased fasting blood glucose and insulin compared to that in wild type mice (Figure 3). The teeny mice also showed insulin resistance at 8-weeks (Figure 4). The adipose tissue beds in the teeny mice were reduced in size compared to that in wild-type mice (Figure 5). The teeny mice had large, pallid livers (Figure 6) and an abundance of stored lipid (Figure 7). Male and female homozygous teeny mice are infertile (1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. The body weight phenotype was linked to a mutation in Kbtbd2: a C to T transition at base pair 56,780,389 (v38) on chromosome 6, equivalent to base pair 17,425 in the GenBank genomic region NC_000072 (2). Linkage was found with a recessive model of inheritance (P = 7.214 x 10-10), wherein 2 homozygous variants departed phenotypically from 11 homozygous reference and 8 heterozygous mice (Figure 8). The mutation corresponds to residue 1,004 in the NM_145958 mRNA sequence in exon 4 of 4 total exons. 989 GTGTTACAGCGTTGCCGAGAATATTTAATTAAA 116 -V--L--Q--R--C--R--E--Y--L--I--K- The mutation, shown in red, results in substitution of an arginine (R) for a premature stop codon at amino acid 121 in the KBTBD2 protein. A CRISPR-generated Kbtbd2 knockout mouse confirmed that the teeny body weight phenotype was caused by the mutation in Kbtbd2 (Figure 9; P = 1.044 x 10-11, recessive model of inheritance) (1). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Kbtbd2 encodes KBTBD2, a member of the BTB (Broad-complex, Tramtrack and Bric à brac)-BACK (BTB and C-terminal kelch)-Kelch (BBK) family of proteins. BBK proteins are predominantly found in vertebrates; there are no known examples of BTB- or BACK-containing proteins in prokaryotes or archae (3). Similar to other BBK proteins (4;5), KBTBD2 contains an N-terminal extension (amino acids 1-30), BTB domain (amino acids 31-128; SMART), a BACK domain (amino acids 133-235) and four kelch repeats (amino acids 317-380, 381-429, 430-469, and 470-532, SMART; (4-6)); Figure 10). The N-terminal extension folds into one β-sheet and one α-helix and contributes to dimerization (6). BTB domains are often associated with other domains including C2H2 zinc finger (for information about a member of the BTB-zinc finger (BTB-ZF) family, ZBTB1, please see the record for scanT) and kelch domains (4). The BTB domain promotes protein-protein interactions including homodimerization and heterodimerization with non-BTB proteins (e.g., transcriptional corepressors and the E3 ligase Cullin 3 (Cul3)) [(4;6); reviewed in (7)]. The ~120-amino acid BTB domains have a common 95-amino acid region, the BTB fold, that consists of a cluster of five α-helices (A1–A5) made up, in part, of two α-helical hairpins (A1/A2 and A4/A5), and capped at one end by a short solvent-exposed three stranded β-sheet (B1/B2/B3) (4). Another hairpin-like motif comprised of A3 and an extended region links the B1/B2/A1/A2/B3 and A4/A5 segments of the fold (4). Although the overall structure of the BTB fold is shared among the BTB-containing proteins, the oligomerization or protein-protein interaction states of the proteins involve different surface-exposed residues (4). Most of the BTB-kelch proteins also contain a highly conserved BACK domain (3;4). The BACK domain is ~130 amino acids, with highest conservation within the first 70 residues immediately following the BTB domain (3). The BACK domains contain a conserved N-terminal Asn-Cys-Leu-Gly-Ile sequence, a Val-Arg-[Leu/Met/Phe]-Pro-Leu-Leu sequence, two arginine residues and four glutamic acids; most of the conserved amino acids are non-polar, indicating that the BACK domain contains a hydrophobic core (3). The functional role of the BACK domain is unknown (3). Kelch motifs are 44 to 56 amino acids in length. Kelch motifs have conserved motifs including four hydrophobic residues followed by a double glycine element separated from two aromatic residues (8). Each kelch motif is a four-stranded β-sheet that, along with the other Kelch motifs, folds into a conserved β-propeller structure to mediate protein-protein interactions with structural proteins, transcription factors, and viral proteins (5;8). Intra- and inter-blade loops protruding from above, below, or at the sides of the β-sheets contribute to the variability in the binding properties of the β-propellers (8;9). The structure is closed and stabilized by interactions between the first and last blades (10;11).
The teeny mutation (Arg121*) is at the C-terminal portion of the BTB domain of ZBTBD2, resulting in the loss of both the BACK and kelch domains. Expression of endogenous KBTBD2 was undetectable by immunoblotting in Kbtbd2tny/tny liver or mouse embryonic fibroblast (MEF) lysates (Figure 11). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization |
KBTBD2 is localized in both the nucleus and cytoplasm (1). Kbtbd2 is expressed at varying levels in all tissues tested, with highly expressed in mouse muscle, liver, brain, iBAT, heart, and eWAT (Figure 12). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
BTB-mediated protein-protein interactions mediate several functions including transcription repression (12;13), cellular signaling, cell cycle regulation, regulation of skeletal muscle gene expression, cytoskeleton regulation (14;15), tetramerization and gating of ion channels (16), and protein ubiquitination/degradation [(8;17); reviewed in (4)]. BTB proteins have been identified as members of the Cul3 Skp1-Cullin-F-box (SCF)-like E3 ubiquitin ligase complex; the BTB proteins facilitate the recruitment of the substrate to Cul3 (18). In addition, kelch repeat-containing proteins often participate in cell morphology and organization via association with the actin cytoskeleton and intermediate filaments, gene expression, and viral binding partners (3;8). Several other members of the KBTBD family have been studied (Table 1). Table 1. Known functions of members of the KBTBD family.
The Src family of non-receptor tyrosine kinases (see the record for iconoclast and Lemon) mediate cell adhesion, invasion, migration, survival, and cell cycle progression through the activation of several signaling pathways. Activation of a Src kinase results in its translocation to the plasma membrane as well as the rapid formation of lamellipodia (33). Src and ezrin, a member of the ezrin-radixin-moesin protein family that links cell surface receptors and the actin cytoskeleton, cooperate in the regulation of cell-cell contacts and the scattering of mammary carcinoma cells (34). Following epidermal growth factor (EGF), platelet-derived growth factor (PDGF), or hepatocyte growth factor (HGF) stimulation, ezrin is phosphorylated on Tyr145 and Y447 by Src (35-37). Interaction of Fes kinase with phosphorylated ezrin promotes HGF-induced scattering of epithelial cells and suggests that an ezrin/Fes interaction is involved in epithelial-mesenchymal transition (38;39). Phosphorylated ezrin is also required for the growth and invasion of Src-transformed fibroblasts in 3-dimensional (3D) matrix cultures (40). Phosphorylation of Tyr477 regulated local invasion and metastasis of breast carcinoma cells (41). Src-mediated phosphorylation of ezrin on Tyr447 induces an interaction with KBTBD2 in adherent cells (33). However, it is unknown how ezrin, Src, and KBTBD2 function in the regulation of the actin cytoskeleton, adhesion, or cellular signaling (33). In an RT-PCR screen, Kbtbd2 was identified as one of several of genes differentially expressed in subcutaneous and visceral adipose tissue in cattle, pigs and mice (42). Expression of the Kbtbd2 mRNA was higher in the subcutaneous than in the visceral adipose tissue of cattle (42). In both pigs and mice fed a control diet, Kbtbd2 was expressed at higher levels in the visceral adipose than in the subcutaneous adipose (42). Kbtbd2 expression was significantly elevated in the subcutaneous adipose tissue in mice fed a high-fat diet (42). In a ChIP-Seq analysis of NRF1 (nuclear respiratory factor 1) target genes in SK-N-SH human neuroblastoma cells, KBTBD2 was one of 2,470 genes that were targeted by NRF1 (43). NRF1 is a transcription factor that activates the expression of several metabolic genes that regulate cellular growth and nuclear genes that function in respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. Analysis of the genes regulated by NRF1 determined that the NRF1 target genes exhibit a significant relationship with the Parkinson’s disease pathway, while several others are Alzheimer’s disease- and Huntington’s disease-related genes (43). The molecular pathways most associated with the 2,470 target genes included “mitochondrial dysfunction”, “regulation of eIF4 and p70S6K signaling”, “protein ubiquitination pathway”, DNA double-strand break repair by non-homologous end joining”, and “EIF2 signaling” indicating that NRF1 target genes function in several processes including protein translation, degradation and DNA damage repair (43).
KBTBD2 interacts with Cul3 through the KBTBD2 N-terminal BTB domain, indicating that it functions as a substrate recognition component of Cul3-based ubitquitin ligase complexes (Figure 14). Mass spectrometry analysis of white adipose tissue from wild-type and Kbtbd2-/- mice determined that p85α, a regulatory subunit of PI3K, was elevated by 40- and 24-fold in Kbtbd2−/− eWAT and iWAT, respectively. In Kbtbd2-/- mice, elevated p85α expression in mouse tissues was observed in adipose tissue, liver, muscle, and brain, as well as in human adipocytes. KBTBD2 binds exclusively to p110-free p85α, leading to its Ub-mediated degradation. KBTBD2 recruits p85α to Cul3 Ub ligase complexes for K48-linked ubiquitination, leading to proteasome-mediated degradation of p85α (1). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | PI3K signaling in response to insulin is impaired in KBTBD2-deficient mice owing to increased amounts of p85α, and that accumulated p85α causes the teeny phenotype. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer teeny_pcr_F: TGTACTCTAGCCAGAGCATGGCAG teeny_pcr_R: GATTACCAGTGTGTGCCACTCATCC Sequencing Primer teeny_seq_F: CTACATTTAAGTTGTCGCTGCTGAG teeny_seq_R: TAAAACTTGACAGTACAGGAGCATC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
Teeny genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. PCR Primers Teeny(F): 5’- TGTACTCTAGCCAGAGCATGGCAG-3’ Teeny(R): 5’- GATTACCAGTGTGTGCCACTCATCC-3’ Sequencing Primer Teeny_seq(F): 5’- CTACATTTAAGTTGTCGCTGCTGAG-3’ Teeny_seq(F): 5’- TAAAACTTGACAGTACAGGAGCATC-3’ PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C ∞ The following sequence of 574 nucleotides (from Genbank genomic region NC_000072 for linear DNA sequence of Kbtbd2) is amplified: 1 tgtactctag ccagagcatg gcagcctctc gcacggtttc ctccttttct acatttaagt 61 tgtcgctgct gaggatgtct atgaggaggt cgtgggacag ctgcatgaag gcttcctggc 121 ggtacacagc cgtgaacttg tgctccacca tcctctttgc actctgcttt aattcttcac 181 aactgaagag gtcagcaaaa ctcagcagcc gcacacagtt ctctgcatta atttttttaa 241 ttaaatattc tcggcaacgc tgtaacacat cttctaccta aaaaaagatg acacgtagaa 301 aaaaaaaggt aaaaagatgc tgagattttg aactcaggac cctgcactgc gatccatact 361 cccagcctcc agtttacttt tatctacgat accacaggtt tcccatagca gatgctcctg 421 tactgtcaag ttttatacgt ttggggtaag agacaagttc ttgcaataac aaaattagac 481 ttctaggcta tacagttttc tatttcttac tcttgcccaa tggcctattt tacctgttct 541 atttaggctg gatgagtggc acacactggt aatc Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (G>A, Chr. (+) strand; C>T, sense strand). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
7. Siggs, O. M., and Beutler, B. (2012) The BTB-ZF Transcription Factors. Cell Cycle. 11, 3358-3369.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek, Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Zhao Zhang, Jennifer Weatherly, Tiana Purrington, and Bruce Beutler |