Phenotypic Mutation 'teeny' (pdf version)
List |< first << previous [record 59 of 132] next >> last >|
Alleleteeny
Mutation Type nonsense
Chromosome6
Coordinate56,780,389 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Kbtbd2
Gene Name kelch repeat and BTB (POZ) domain containing 2
Synonym(s) Bklhd1
Chromosomal Location 56,777,524-56,797,813 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele or mutation exhibit diabetes, lipodystrophy, and hepatic steatosis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145958; MGI:2384811

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000109960] [ENSMUSP00000109962]
SMART Domains Protein: ENSMUSP00000109960
Gene: ENSMUSG00000059486
AA Change: R121*

DomainStartEndE-ValueType
BTB 31 128 1.5e-28 SMART
BACK 133 235 7.34e-27 SMART
Kelch 317 380 7.31e0 SMART
Kelch 381 429 4.33e-4 SMART
Kelch 430 469 2.7e0 SMART
Kelch 470 532 7.7e0 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000109962
Gene: ENSMUSG00000059486
AA Change: R121*

DomainStartEndE-ValueType
BTB 31 128 1.5e-28 SMART
BACK 133 235 7.34e-27 SMART
Kelch 317 380 7.31e0 SMART
Kelch 381 429 4.33e-4 SMART
Kelch 430 469 2.7e0 SMART
Kelch 470 532 7.7e0 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hyperglycemic 27708159
Body Weight - decreased 27708159
Body Weight (Female) - decreased 27708159
Body Weight (Male) - decreased 27708159
FACS CD44+ CD8 T cells - increased
growth/size 27708159
liver/biliary system
Penetrance  
Alleles Listed at MGI

All alleles(43) : Targeted(2) Gene trapped(41)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Kbtbd2 APN 6 56779048 missense possibly damaging 0.94
infinitesimal UTSW 6 56779090 missense probably damaging 1.00
tiny UTSW 6 56779206 missense
R0491:Kbtbd2 UTSW 6 56780389 nonsense probably null
R1452:Kbtbd2 UTSW 6 56781924 missense probably damaging 0.98
R1696:Kbtbd2 UTSW 6 56779341 missense probably benign 0.00
R2146:Kbtbd2 UTSW 6 56779090 missense probably damaging 1.00
R4563:Kbtbd2 UTSW 6 56789279 missense probably benign
R4579:Kbtbd2 UTSW 6 56778908 missense probably damaging 0.99
R4702:Kbtbd2 UTSW 6 56779303 missense probably benign 0.00
R4855:Kbtbd2 UTSW 6 56779702 missense probably benign 0.01
R4959:Kbtbd2 UTSW 6 56781958 missense probably benign 0.11
R4973:Kbtbd2 UTSW 6 56781958 missense probably benign 0.11
R5096:Kbtbd2 UTSW 6 56779275 missense probably benign 0.06
R6360:Kbtbd2 UTSW 6 56779206 missense probably damaging 0.99
R6754:Kbtbd2 UTSW 6 56779254 missense probably damaging 0.99
R6864:Kbtbd2 UTSW 6 56780026 nonsense probably null
R6900:Kbtbd2 UTSW 6 56780023 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2018-07-20 9:29 AM by Anne Murray
Record Created 2013-05-18 10:00 AM by Jennifer Weatherly
Record Posted 2016-10-13
Phenotypic Description
Figure 1. The teeny phenotype. Photograph of a male teeny homozygote (tny/tny) and WT (+/+) littermate at 8 wk of age. (Scale bar: 1 cm.) Image adapted from (1).

Figure 2. Homozygous teeny mice exhibit reduced body weights. Scaled body weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. The teeny phenotype. Blood glucose (left), and serum insulin (right) of 8-wk-old mice. Glucose and insulin were measured after a 6-h fast. Image adapted from (1).
Figure 4. The teeny phenotype. Insulin tolerance test. Blood glucose was measured at indicated times after i.p. insulin injection in 8-wk-old male mice (n = 3). The baseline blood glucose levels (0 min) of tny/tny and WT littermates were 626 ± 31 mg/dL and 168 ± 8 mg/dL, respectively. Image adapted from (1).
Figure 5. The teeny phenotype. (left) Representative photographs of BAT, eWAT, and iWAT from 20-wk-old male mice. (Scale bars: 1 cm.) (right) Weights of BAT, eWAT, and iWAT normalized to body weight in 20-wk-old male mice (n = 3). Image adapted from (1).
Figure 6. The teeny phenotype. Representative photographs of liver from 8-wk-old male mice. (Scale bar: 1 cm.) Image adapted from (1).
Figure 7. The teeny phenotype. Liver sections of 20-wk-old male mice stained with H&E (T and U) and Oil red O (V and W). (Scale bars: 30 μm.) Image adapted from (1).

The teeny phenotype was identified among G3 mice of the pedigree R0491 (1).  The teeny mice exhibit decreased body sizes (Figure 1) and body weights compared to their wild-type littermates (Figure 2). The teeny mice also showed increased fasting blood glucose and insulin compared to that in wild type mice (Figure 3).  The teeny mice also showed insulin resistance at 8-weeks (Figure 4). The adipose tissue beds in the teeny mice were reduced in size compared to that in wild-type mice (Figure 5). The teeny mice had large, pallid livers (Figure 6) and an abundance of stored lipid (Figure 7).

 

Male and female homozygous teeny mice are infertile (1).

Nature of Mutation

Figure 8. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R0491. Scaled weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 9. Kbtbd2 CRISPR KO mice reproduce the teeny body weight phenotype. Kbtbd2 CRISPR KO mice and B6 mice were weighed at 8 weeks of age. Normized data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. The body weight phenotype was linked to a mutation in Kbtbd2: a C to T transition at base pair 56,780,389 (v38) on chromosome 6, equivalent to base pair 17,425 in the GenBank genomic region NC_000072 (2).  Linkage was found with a recessive model of inheritance (P = 7.214 x 10-10), wherein 2 homozygous variants departed phenotypically from 11 homozygous reference and 8 heterozygous mice (Figure 8).

 

The mutation corresponds to residue 1,004 in the NM_145958 mRNA sequence in exon 4 of 4 total exons.

 

989 GTGTTACAGCGTTGCCGAGAATATTTAATTAAA
116 -V--L--Q--R--C--R--E--Y--L--I--K-

 

The mutation, shown in red, results in substitution of an arginine (R) for a premature stop codon at amino acid 121 in the KBTBD2 protein.

 

A CRISPR-generated Kbtbd2 knockout mouse confirmed that the teeny body weight phenotype was caused by the mutation in Kbtbd2 (Figure 9; P = 1.044 x 10-11, recessive model of inheritance) (1).

Protein Prediction
Figure 10. Domain structure of the KBTBD2 protein. KBTBD2 is a member of the BTB-BACK-kelch protein family. The teeny mutation (R121*) is indicated. Please see the text for more details about these domains. Abbreviations: NTE, N-terminal extension; BTB, Broad-complex, Tramtrack and Bric à brac domain; BACK, BTB and C-terminal kelch domain. The image is interactive; click to view additional mutations in KBTBD2. Click on the mutation to connect to the mutation page.

Kbtbd2 encodes KBTBD2, a member of the BTB (Broad-complex, Tramtrack and Bric à brac)-BACK (BTB and C-terminal kelch)-Kelch (BBK) family of proteins. BBK proteins are predominantly found in vertebrates; there are no known examples of BTB- or BACK-containing proteins in prokaryotes or archae (3). Similar to other BBK proteins (4;5), KBTBD2 contains an N-terminal extension (amino acids 1-30), BTB domain (amino acids 31-128; SMART), a BACK domain (amino acids 133-235) and four kelch repeats (amino acids 317-380, 381-429, 430-469, and 470-532, SMART; (4-6)); Figure 10).

 

The N-terminal extension folds into one β-sheet and one α-helix and contributes to dimerization (6). BTB domains are often associated with other domains including C2H2 zinc finger (for information about a member of the BTB-zinc finger (BTB-ZF) family, ZBTB1, please see the record for scanT) and kelch domains (4). The BTB domain promotes protein-protein interactions including homodimerization and heterodimerization with non-BTB proteins (e.g., transcriptional corepressors and the E3 ligase Cullin 3 (Cul3)) [(4;6); reviewed in (7)]. The ~120-amino acid BTB domains have a common 95-amino acid region, the BTB fold, that consists of a cluster of five α-helices (A1–A5) made up, in part, of two α-helical hairpins (A1/A2 and A4/A5), and capped at one end by a short solvent-exposed three stranded β-sheet (B1/B2/B3) (4). Another hairpin-like motif comprised of A3 and an extended region links the B1/B2/A1/A2/B3 and A4/A5 segments of the fold (4). Although the overall structure of the BTB fold is shared among the BTB-containing proteins, the oligomerization or protein-protein interaction states of the proteins involve different surface-exposed residues (4).

 

Most of the BTB-kelch proteins also contain a highly conserved BACK domain (3;4). The BACK domain is ~130 amino acids, with highest conservation within the first 70 residues immediately following the BTB domain (3). The BACK domains contain a conserved N-terminal Asn-Cys-Leu-Gly-Ile sequence, a Val-Arg-[Leu/Met/Phe]-Pro-Leu-Leu sequence, two arginine residues and four glutamic acids; most of the conserved amino acids are non-polar, indicating that the BACK domain contains a hydrophobic core (3). The functional role of the BACK domain is unknown (3).  

 

Kelch motifs are 44 to 56 amino acids in length. Kelch motifs have conserved motifs including four hydrophobic residues followed by a double glycine element separated from two aromatic residues (8). Each kelch motif is a four-stranded β-sheet that, along with the other Kelch motifs, folds into a conserved β-propeller structure to mediate protein-protein interactions with structural proteins, transcription factors, and viral proteins (5;8). Intra- and inter-blade loops protruding from above, below, or at the sides of the β-sheets contribute to the variability in the binding properties of the β-propellers (8;9). The structure is closed and stabilized by interactions between the first and last blades (10;11).

 

Figure 11. Mutation of Kbtbd2 causes the tny phenotype. Immunoblots of liver (C) and mouse embryonic fibroblast (D) lysates from two male homozygous tny mice and WT littermates. Image adapted from (1).

The teeny mutation (Arg121*) is at the C-terminal portion of the BTB domain of ZBTBD2, resulting in the loss of both the BACK and kelch domains. Expression of endogenous KBTBD2 was undetectable by immunoblotting in Kbtbd2tny/tny liver or mouse embryonic fibroblast (MEF) lysates (Figure 11).

Expression/Localization
Figure 12. Expression profile of the Kbtbd2 transcript. Kbtbd2 transcript levels normalized to Actb mRNA in different tissues of male C57BL/6J mice at 8 wk of age (n = 3). Image adapted from (1).

KBTBD2 is localized in both the nucleus and cytoplasm (1). Kbtbd2 is expressed at varying levels in all tissues tested, with highly expressed in mouse muscle, liver, brain, iBAT, heart, and eWAT (Figure 12).

Background

Figure 13. KBTBD2 and other BTB proteins function in the Cul3 E3 ubiquitin ligase complex. The BTB proteins facilitate the recruitment of the substrate to Cul3. Ubiquitination is carried out by three enzymes: E1 (activating enzyme), E2 (conjugating enzyme, and E3 (ubiquitin ligases). The ubiquitin cascade results in the binding of ubiquitin to the protein substrate.

BTB-mediated protein-protein interactions mediate several functions including transcription repression (12;13), cellular signaling, cell cycle regulation, regulation of skeletal muscle gene expression, cytoskeleton regulation (14;15), tetramerization and gating of ion channels (16), and protein ubiquitination/degradation [(8;17); reviewed in (4)]. BTB proteins have been identified as members of the Cul3 Skp1-Cullin-F-box (SCF)-like E3 ubiquitin ligase complex; the BTB proteins facilitate the recruitment of the substrate to Cul3 (18). In addition, kelch repeat-containing proteins often participate in cell morphology and organization via association with the actin cytoskeleton and intermediate filaments, gene expression, and viral binding partners (3;8). Several other members of the KBTBD family have been studied (Table 1).

 

Table 1. Known functions of members of the KBTBD family.

Gene symbol

Known function

Human phenotype

References

Kbtbd1 (alternatively Klhl31)

Acts as a transcriptional repressor of the TPA-response element (TRE) and serum response element (SRE) in mitogen-activated kinase (MAPK) /JNK signaling; Unknown function in vertebrate myogenesis

Undetermined

(19;20)

Kbtbd2 (alternatively, Bklhd1)

See text

Undetermined

-

Kbtbd3

Undetermined

Undetermined

-

Kbtbd4

Cullin ring ligand (CRL) substrate

Undetermined

(21)

Kbtbd5 (alternatively, Klhl40)

Recruits the Cul3 complex; expression is upregulated during skeletal muscle differentiation

Mutations in KLHL40 are linked to nemaline myopathy-8 (OMIM #615348)

(22;23)

Kbtbd6

CRL substrate

Undetermined

(21)

Kbtbd7

Activates the transcriptional activites of activator protein-1 (AP-1) and serum response element (SRE) in MAPK signaling

Undetermined

(24)

Kbtbd8

Colocalizes with α-tubulin on the spindle apparatus in mitotic cells

Undetermined

(25)

Kbtbd9/Klhl29

Undetermined

Undetermined

-

Kbtbd10/Klhl41/Sarcosin/Krp1

Regulates muscle development and differentiation; increases mesenchymal invasion; promotes the assembly of myofibrils; regulates proliferation and differentiation of myoblasts

Mutations in KLHL41 are linked to nemaline myopathy

(26-30)

Kbtbd11/Klhdc7

Undetermined

Undetermined

-

Kbtbd12/Klhdc6

Interacts with human alpha A-crystallin

Undetermined

(31)

Kbtbd13/Nem6

Undetermined

Mutations in KBTBD13 are linked to nemaline myopathy type 6 (OMIM: #609273)

(32)

 

The Src family of non-receptor tyrosine kinases (see the record for iconoclast and Lemon) mediate cell adhesion, invasion, migration, survival, and cell cycle progression through the activation of several signaling pathways. Activation of a Src kinase results in its translocation to the plasma membrane as well as the rapid formation of lamellipodia (33). Src and ezrin, a member of the ezrin-radixin-moesin protein family that links cell surface receptors and the actin cytoskeleton, cooperate in the regulation of cell-cell contacts and the scattering of mammary carcinoma cells (34). Following epidermal growth factor (EGF), platelet-derived growth factor (PDGF), or hepatocyte growth factor (HGF) stimulation, ezrin is phosphorylated on Tyr145 and Y447 by Src (35-37). Interaction of Fes kinase with phosphorylated ezrin promotes HGF-induced scattering of epithelial cells and suggests that an ezrin/Fes interaction is involved in epithelial-mesenchymal transition (38;39). Phosphorylated ezrin is also required for the growth and invasion of Src-transformed fibroblasts in 3-dimensional (3D) matrix cultures (40). Phosphorylation of Tyr477 regulated local invasion and metastasis of breast carcinoma cells (41). Src-mediated phosphorylation of ezrin on Tyr447 induces an interaction with KBTBD2 in adherent cells (33). However, it is unknown how ezrin, Src, and KBTBD2 function in the regulation of the actin cytoskeleton, adhesion, or cellular signaling (33).

 

In an RT-PCR screen, Kbtbd2 was identified as one of several of genes differentially expressed in subcutaneous and visceral adipose tissue in cattle, pigs and mice (42). Expression of the Kbtbd2 mRNA was higher in the subcutaneous than in the visceral adipose tissue of cattle (42). In both pigs and mice fed a control diet, Kbtbd2 was expressed at higher levels in the visceral adipose than in the subcutaneous adipose (42). Kbtbd2 expression was significantly elevated in the subcutaneous adipose tissue in mice fed a high-fat diet (42).  

 

In a ChIP-Seq analysis of NRF1 (nuclear respiratory factor 1) target genes in SK-N-SH human neuroblastoma cells, KBTBD2 was one of 2,470 genes that were targeted by NRF1 (43). NRF1 is a transcription factor that activates the expression of several metabolic genes that regulate cellular growth and nuclear genes that function in respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. Analysis of the genes regulated by NRF1 determined that the NRF1 target genes exhibit a significant relationship with the Parkinson’s disease pathway, while several others are Alzheimer’s disease- and Huntington’s disease-related genes (43). The molecular pathways most associated with the 2,470 target genes included “mitochondrial dysfunction”, “regulation of eIF4 and p70S6K signaling”, “protein ubiquitination pathway”, DNA double-strand break repair by non-homologous end joining”, and “EIF2 signaling” indicating that NRF1 target genes function in several processes including protein translation, degradation and DNA damage repair (43).

 

Figure 14. Regulation of p85α by KBTBD2 in WT and tny/tny mice. In WT mice, KBTBD2 regulates p85α protein abundance through degradation mediated by K48 ubiquitination. Insulin induces phosphorylated IRS-1 to recruit p85α-p110 heterodimers, leading to activation of PI3K catalytic activity and downstream signaling. In KBTBD2-deficient tny/tny mice, excess p85α constitutively precludes the association of p85-p110 heterodimers with phosphorylated IRS-1, resulting in impaired PI3K signaling in response to insulin. Image adapted from (1).

KBTBD2 interacts with Cul3 through the KBTBD2 N-terminal BTB domain, indicating that it functions as a substrate recognition component of Cul3-based ubitquitin ligase complexes (Figure 14). Mass spectrometry analysis of white adipose tissue from wild-type and Kbtbd2-/- mice determined that p85α, a regulatory subunit of PI3K, was elevated by 40- and 24-fold in Kbtbd2−/− eWAT and iWAT, respectively. In Kbtbd2-/- mice, elevated p85α expression in mouse tissues was observed in adipose tissue, liver, muscle, and brain, as well as in human adipocytes. KBTBD2 binds exclusively to p110-free p85α, leading to its Ub-mediated degradation. KBTBD2 recruits p85α to Cul3 Ub ligase complexes for K48-linked ubiquitination, leading to proteasome-mediated degradation of p85α (1).

Putative Mechanism

PI3K signaling in response to insulin is impaired in KBTBD2-deficient mice owing to increased amounts of p85α, and that accumulated p85α causes the teeny phenotype.

Primers PCR Primer
teeny(F):5'- TGTACTCTAGCCAGAGCATGGCAG -3'
teeny(R):5'- GATTACCAGTGTGTGCCACTCATCC -3'

Sequencing Primer
teeny_seq(F):5'- CTACATTTAAGTTGTCGCTGCTGAG -3'
teeny_seq(R):5'- TAAAACTTGACAGTACAGGAGCATC -3'
Genotyping
Genotyping DNA trace file (Chr. + strand).

Teeny genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Teeny(F): 5’- TGTACTCTAGCCAGAGCATGGCAG-3’

Teeny(R): 5’- GATTACCAGTGTGTGCCACTCATCC-3’

 

Sequencing Primer

Teeny_seq(F): 5’- CTACATTTAAGTTGTCGCTGCTGAG-3’
 

Teeny_seq(F): 5’- TAAAACTTGACAGTACAGGAGCATC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 574 nucleotides (from Genbank genomic region NC_000072 for linear DNA sequence of Kbtbd2) is amplified:

 

  1 tgtactctag ccagagcatg gcagcctctc gcacggtttc ctccttttct acatttaagt

 61 tgtcgctgct gaggatgtct atgaggaggt cgtgggacag ctgcatgaag gcttcctggc       

121 ggtacacagc cgtgaacttg tgctccacca tcctctttgc actctgcttt aattcttcac      

181 aactgaagag gtcagcaaaa ctcagcagcc gcacacagtt ctctgcatta atttttttaa      

241 ttaaatattc tcggcaacgc tgtaacacat cttctaccta aaaaaagatg acacgtagaa      

301 aaaaaaaggt aaaaagatgc tgagattttg aactcaggac cctgcactgc gatccatact      

361 cccagcctcc agtttacttt tatctacgat accacaggtt tcccatagca gatgctcctg      

421 tactgtcaag ttttatacgt ttggggtaag agacaagttc ttgcaataac aaaattagac      

481 ttctaggcta tacagttttc tatttcttac tcttgcccaa tggcctattt tacctgttct      

541 atttaggctg gatgagtggc acacactggt aatc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (G>A, Chr. (+) strand; C>T, sense strand).

References
  23. Ravenscroft, G., Miyatake, S., Lehtokari, V. L., Todd, E. J., Vornanen, P., Yau, K. S., Hayashi, Y. K., Miyake, N., Tsurusaki, Y., Doi, H., Saitsu, H., Osaka, H., Yamashita, S., Ohya, T., Sakamoto, Y., Koshimizu, E., Imamura, S., Yamashita, M., Ogata, K., Shiina, M., Bryson-Richardson, R. J., Vaz, R., Ceyhan, O., Brownstein, C. A., Swanson, L. C., Monnot, S., Romero, N. B., Amthor, H., Kresoje, N., Sivadorai, P., Kiraly-Borri, C., Haliloglu, G., Talim, B., Orhan, D., Kale, G., Charles, A. K., Fabian, V. A., Davis, M. R., Lammens, M., Sewry, C. A., Manzur, A., Muntoni, F., Clarke, N. F., North, K. N., Bertini, E., Nevo, Y., Willichowski, E., Silberg, I. E., Topaloglu, H., Beggs, A. H., Allcock, R. J., Nishino, I., Wallgren-Pettersson, C., Matsumoto, N., and Laing, N. G. (2013) Mutations in KLHL40 are a Frequent Cause of Severe Autosomal-Recessive Nemaline Myopathy. Am J Hum Genet. 93, 6-18.
Science Writers Anne Murray
Illustrators Peter Jurek, Katherine Timer
AuthorsZhao Zhang, Jennifer Weatherly, Tiana Purrington, and Bruce Beutler
List |< first << previous [record 59 of 132] next >> last >|