Phenotypic Mutation 'gandalf' (pdf version)
List |< first << previous [record 95 of 132] next >> last >|
Allelegandalf
Mutation Type nonsense
Chromosome3
Coordinate20,012,796 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Hps3
Gene Name HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonym(s) coa, cocoa
Chromosomal Location 19,995,945-20,035,315 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_080634; MGI: 2153839

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000003714] [ENSMUSP00000012580] [ENSMUSP00000103957]
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: C667*

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: C535*

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation 3408670
skin/coat/nails 3408670
Penetrance  
Alleles Listed at MGI

All alleles(12) : Targeted(4) Gene trapped(1) Spontaneous(6) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20019807 missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20025792 missense probably benign 0.00
IGL01320:Hps3 APN 3 20030469 missense probably benign 0.12
IGL01364:Hps3 APN 3 20003305 missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20010966 missense probably damaging 1.00
IGL01843:Hps3 APN 3 20029001 missense probably benign 0.05
IGL02294:Hps3 APN 3 20014048 missense probably damaging 1.00
IGL02581:Hps3 APN 3 20003221
blue UTSW 3 20030796 missense probably damaging 1.00
earl_grey UTSW 3 20017173 nonsense
pam_gray UTSW 3 20017173 nonsense
R0107:Hps3 UTSW 3 20030796 missense probably damaging 1.00
R0245:Hps3 UTSW 3 20012796 nonsense probably null
R0421:Hps3 UTSW 3 20029316 missense probably benign 0.00
R0524:Hps3 UTSW 3 20012776 missense probably damaging 1.00
R0763:Hps3 UTSW 3 20003279 missense probably damaging 1.00
R1795:Hps3 UTSW 3 20012695 critical splice donor site probably null
R1864:Hps3 UTSW 3 20019959 critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20030527 missense probably benign 0.01
R2101:Hps3 UTSW 3 20012783 missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20002363 missense probably benign
R2268:Hps3 UTSW 3 20012935 splice site probably benign
R2520:Hps3 UTSW 3 20029030 missense probably damaging 1.00
R3809:Hps3 UTSW 3 20018812 missense probably damaging 1.00
R3888:Hps3 UTSW 3 20003223 critical splice donor site probably null
R3942:Hps3 UTSW 3 19996939 missense probably damaging 1.00
R4022:Hps3 UTSW 3 20035261 missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20029229 missense probably damaging 1.00
R4739:Hps3 UTSW 3 20030410 critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20012726 missense probably benign 0.03
R4912:Hps3 UTSW 3 20014173 missense probably damaging 1.00
R5307:Hps3 UTSW 3 20012701 missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20008870 missense probably benign 0.02
R6140:Hps3 UTSW 3 19996987 missense probably damaging 1.00
R6183:Hps3 UTSW 3 20008868 missense probably benign 0.04
R6971:Hps3 UTSW 3 20011535 missense probably damaging 1.00
R6981:Hps3 UTSW 3 20022820 missense probably damaging 1.00
X0021:Hps3 UTSW 3 20030749 missense probably benign 0.14
X0066:Hps3 UTSW 3 20015988 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038245-MU
Last Updated 2017-05-31 4:22 PM by Katherine Timer
Record Created 2013-05-23 8:58 AM by Tiana Purrington
Record Posted 2014-03-28
Phenotypic Description
Figure 1. The gandalf mouse has gray fur.

Gandalf was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals as a hypopigmentation mutant (Figure 1). The gandalf homozygous mice have a gray coat. 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations, one of which affected Hps3, a gene known to affect coat pigmentation. Gandalf phenocopies the pam gray phenotype attributed to Hps3. Therefore, the gandalf phenotype was ascribed to the Hps3 mutation, a T to A transversion at base pair 20012796 (v38) on Chromosome 3, or 22515 in the GenBank genomic region NC_000069 encoding Hps3. The mutation corresponds to residue 2046 in the mRNA sequence NM_080634 within exon 11 of 17 total exons.

 

2029 AGGAAGCTGGATAGTTGTGGAGTTTCACCCGTC
662  -R--K--L--D--S--C--G--V--S--P--V-

 

The mutated nucleotide is indicated in red.  The mutation results in a cysteine (C) to premature stop codon substitution at residue 667 of the HPS3 protein.

 

Protein Prediction
Figure 2. A, Predicted domains of HPS3. HPS3 contains a putative clathrin-binding (CB) motif, two consensus dileucine-based sorting motifs and an endoplasmic reticulum (ER) membrane retention signal. Amino acid locations are based on the human protein. The location of the gandalf mutation is indicated in red. Image is interactive: click to see other mutations in Hps3 (red indicates phenotypic mutations; green are incidental mutations). B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?).

The gandalf mutation (C667*) may result in nonsense mediated decay of the transcript, or expression of an HPS3 protein truncated after amino acid 667 (Figure 2). The truncated protein would lack one of two dileucine-based sorting motifs and the ER retention signal. Expression and localization of this protein has not been tested. 

 

Please see the record pam gray for information about Hps3.

Putative Mechanism

Mutations in Hps3 have been documented to result in pigmentation defects [(1); MGI:2153839; pam gray; blue]. Mutations in Hps3 may alter protein (e.g., tyrosinase, Tyrp1, Tyrp2, LAMP1 and LAMP3) trafficking during the maturation of melanosomes, resulting in hypopigmentation (2;3).

Primers PCR Primer
gandalf(F):5'- TGTTGTGCTTTCAGTGAACACCTACTC -3'
gandalf(R):5'- AGACAGATCATGTCAGCTCAGTTTTGG -3'

Sequencing Primer
gandalf_seq(F):5'- TGGCTCTGGACATAGCTTTATAC -3'
gandalf_seq(R):5'- CGTAATCTCTGTCTTTCTCAATAGC -3'
Genotyping
DNA trace file of genotyping. Chr. + shown.

Gandalf genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Gandalf(F): 5’- TGTTGTGCTTTCAGTGAACACCTACTC -3’

Gandalf(R): 5’- AGACAGATCATGTCAGCTCAGTTTTGG -3’

 

Sequencing Primer

Gandalf_seq(F): 5’- TGGCTCTGGACATAGCTTTATAC -3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 706 nucleotides is amplified (Chr. 3: 20012389-20013094, GRCm38):

 

  1 tgttgtgctt tcagtgaaca cctactctaa ttgttggctc tggacatagc tttatactct

 61 tctgtgtgaa caaacataat attctgaata tatgtggtac agtgatgatg aaagatcttt

121 cagtagccac tgctgatatt tatcaatctt ttttatttcc atttgacaga tctaaagttc

181 catctaacac tgtctgtttt ctgttactaa gaaaccatga ggtacaaaga agccagaaga

241 aagcccaatg gctcaggaac tactctaatt ctctttcaga cttgttaaca ccaggcattg

301 tactatacct ccgaatggct tttcatctca tttctgtaca tgtcaagatc tcccattttc

361 aaggccactg cagccttggt caaggtcact aagacgggtg aaactccaca actatccagc

421 ttccttaaat aatgcaaggc agttaaggga tcaatattct tcatagaagg gctagagaga

481 acatgaggca gctgcttcgg ctcagccatg tggaatatct gagccacttt tgctgctaat

541 tcctttgatg aatatgaaca aaaaataaac cgttagccaa taggaaacag gggacaaaaa

601 ggaaggaagg tataaaatgc actagataaa taatataatg ctattgagaa agacagagat

661 tacgaaaata tttgaaaggc caaaactgag ctgacatgat ctgtct

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (A>T, Chr. + strand; T>A, sense strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsTiana Purrington
List |< first << previous [record 95 of 132] next >> last >|