Phenotypic Mutation 'duke'

• Allele: duke
• Mutation Type: missense
• Chromosome: 13
• Coordinate: 53,622,431 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Msx2
• Gene Name: msh homeobox 2
• Synonym(s): Hox-8, Hox8.1, Hox8
• Chromosomal Location: 53,620,917-53,626,816 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the muscle segment homeobox gene family. The encoded protein is a transcriptional repressor whose normal activity may establish a balance between survival and apoptosis of neural crest-derived cells required for proper craniofacial morphogenesis. The encoded protein may also have a role in promoting cell growth under certain conditions and may be an important target for the RAS signaling pathways. Mutations in this gene are associated with parietal foramina 1 and craniosynostosis type 2. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective skull ossification with persistent calvarial foramen, alopecia, stubby and curly whiskers, seizures, and impaired development of teeth, cerebellum, and mammary gland. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000021922]
• AlphaFold: Q03358
• SMART Domains: Protein: ENSMUSP00000021922; Gene: ENSMUSG00000021469; AA Change: R193L

Domain	Start	End	E-Value	Type
low complexity region	15	37	N/A	INTRINSIC
HOX	142	204	3.2e-25	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000021922)
• Meta Mutation Damage Score: 0.9352
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 037116-MU
• Last Updated: 2016-05-13 3:09 PM by Anne Murray
• Record Created: 2013-06-11 9:38 AM by Jennifer Weatherly
• Record Posted: 2014-09-15
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Jennifer Weatherly Tiana Purrington Bruce Beutler

Accession Number

Accession Number: NCBI RefSeq: NM_013601; MGI:97169

Alleles Listed at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Phenotypic Description

Figure 1. The duke mice exhibit cyclic hair growth and loss. (A) Duke male at weaning (left) with a wild-type sibling (right). (B) Duke male two weeks after weaning. (C) (left) duke male and (right) duke female approximately three weeks post-weaning. (D) Duke male several weeks post-weaning.

The duke phenotype was initially identified among G3 mice of the pedigree R0448, some of which exhibited cyclic alopecia beginning at or around weaning age (postnatal day 21) (Figure 1). Some mice also exhibited microphthalmia.  

Nature of Mutation

Figure 2. Linkage mapping of the duke phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R0448. Binary phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The alopecia phenotype was linked to a mutation in Msx2:  a G to T transversion at base pair 53,468,395 (v38) on chromosome 13, equivalent to base pair 388,435 in the GenBank genomic region NC_000079.  Linkage was found with a recessive model of inheritance (P = 6.30 x 10^-4), wherein 2 variant homozygotes departed phenotypically from 13 unaffected mice that were either heterozygous (n = 5) or homozygous (n = 8) for the reference allele (Figure 2). The mutation corresponds to residue 648 in the NM_013601 mRNA sequence in exon 2 of 2 total exons.

632 ATCTGGTTCCAGAACCGAAGGGCTAAGGCGAAA

188 -I--W--F--Q--N--R--R--A--K--A--K-

The mutated nucleotide is indicated in red.  The mutation results in an arginine  (R) to leucine (L) substitution at residue 193 (R193L) in the MSX2 protein. The mutation is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Protein Prediction

Msx2 encodes MSX2 (alternatively, Hox-8), a member of the highly conserved muscle-segment homeobox (Msh/Msx) gene family that also includes the transcriptional repressors MSX1 and MSX3; MSX1, 2, and 3 all function in development (5-9). Although MSX1 and MSX2 have similar DNA binding site preferences, the N-terminal domains of the two proteins exhibit unique biochemical properties; the N-terminal domain of MSX2 facilitates a greater affinity for DNA than MSX1, while the N-terminal domain of MSX1 renders it a more potent repressor than MSX2 [(8); reviewed in (10)]. MSX1 and MSX2 both have roles as downstream effectors of bone morphogenetic protein (BMP) signaling (11;12). Double knockout (Msx1^-/-Msx2^-/-) mice exhibited synergistic defects in skull, tooth, ear, limb, hair follicle, heart, and mammary gland development; the phenotypes in these tissues was more severe than those observed in in Msx1^-/- or Msx2^-/- knockout mice [(13); reviewed in (10)]. 

Figure 3. Domain structure of MSX2. The location of the homeobox domain (HOX) is indicated and numbered. The location of the duke mutation is shown with a red asterisk.

Figure 4. Crystal structure of the mouse MSX1 homeobox domain/DNA complex. The homeobox domain is shown is gold, while the DNA (a 16 bp oligopeptide, sequence: 5' -TGTCACTAATTGAAGG -3') is shown in blue. The image is interactive; click to rotate. Figure was generated using Chimera software and was adapted from PDB:1IG7; (14).

Amino acids 142-204 (SMART) of mouse MSX2 comprises the DNA-binding homeobox domain (Figure 3). The homeobox domains of MSX1 and MSX2 share high amino acid identity (8). The crystal structure of the MSX1 homeobox domain in complex with DNA has been solved to 2.2 Å (Figure 4; PDB:1IG7; (14)). The homeobox domain of MSX1 consists of a core structure of three helices plus an N-terminal arm that extends outward from the core (14). When bound to DNA, the recognition helix of the homeobox domain runs across the major groove of the DNA, while the N-terminal arm of the homeobox domain tracks the minor groove of the DNA (14). The homeobox domain is stabilized by the formation of three salt bridges: the salt bridge between E30 and E23 links helix one with helix two, the salt bridge between E42 and E31 links helix two with helix three, and the salt bridge between E17 and R52 links helix three with helix one (14).

Exogenous expression of MSX2 truncation variants in MC3T3-E1 mouse calvarial osteoblasts determined that amino acids 97-208 of MSX2 are essential to mediate MSX2-associated suppresser function; amino acids 132-148, overlapping with the N-terminal extension, are responsible for the core suppressor function of MSX2 and are are essential for interactions between components of the basal transcriptional machinery (e.g., TFIIF (RAP74 and RAP30) and other homeobox domain-containing proteins) to facilitate transcription repression [(15;16;17); reviewed in (10)].

 

Protein kinase C (PKC)β can phosphorylate MSX2 at Thr135 and Thr141 (18). Mutations in either Thr135 or Thr141 reduced MSX2 stability and the PKC-associated MSX2 repression of Runx2 transcription, a transcription factor in osteogenic differentiation (18).

 

The duke mutation (R193L) is within the homeobox domain of MSX2.

Expression/Localization

Figure 5. MSX2 localizes to sites of epithelial-mesenchymal interactions during embryogenesis and organogenesis. Germ discs sectioned through the region of the primitive streak, showing gastrulation. The ingressing epiblast cells replace the hypoblast to form the definitive endoderm. The epiblast that ingresses subsequently migrates between the endoderm and epiblast layers to form the intraembryonic mesoderm.

Msx2 is widely expressed throughout embryogenesis and organogenesis at sites where epithelial-mesenchymal interactions occur during cell differentiation (19) (Figure 5). In early development, Msx2 is expressed in the primitive streak ectoderm and mesoderm (7). Later in development, Msx2 is expressed in the lateral surface ectoderm, lateral mesoderm, and the neuroepithelium that will form the dorsal part of the neural tube [(20); reviewed in (7)]. As development progresses, Msx2 is expressed in the eyes, hair follicles, salivary glands, mammary gland epithelium, nail, tooth, retina, maxillary pad, dorsal neuroepithelium of the hindbrain, Purkinje cells of the cerebellum, pharyngeal arches, pericardium of the heart, ear, nose, roof plate, skin, cranial sensory placodes, the skull, and the apical ectodermal ridge of developing limb buds (1;2;7;10;19;21-32).  Msx2 expression in several of these tissues is described in more detail, below.

Msx2 is expressed in the hair follicle placode ectoderm and in epithelial matrix cells during mouse embryogenesis (2). During the anagen phase of the hair cycle, Msx2 is expressed in the matrix cells of the hair bulb and in the hair shaft (2). At postnatal day (P) 3, Msx2 is expressed in the hair bulb, including the germinative matrix of the hair follicle (2). At P7, Msx2 is expressed in the hair matrix and the differentiation hair cortex of anagen hair follicles (2). By P11, Msx2 is upregulated and is expressed within the upper region of the hair follicle, including the hair cortex.

Both the Msx2 gene and the MSX2 protein are expressed in the nail bed and nail matrix, including the basal layer (32;33). In human skin, MSX2 is expressed throughout the epidermis and dermis during development; greatest expression is within the suprabasal epithelial layer (34). In the adult, MSX2 expression is within the basal and suprabasal layers of the epidermis, with strongest expression within the hair follicles (34). 

During craniofacial development, Msx2 is expressed in the forming skull (namely, the suture mesenchyme and dura mater) and meninges, the distal aspects of the facial primordial, the associated sense organs, and teeth (25). At embryonic day (E) 10.5, Msx2 is expressed in the presumptive frontal bone mesenchyme, and by E11.5 Msx2 is expressed in the primordial of the frontal and parietal bones (35). At E12.5, Msx2 is expressed in the preosteogenic and osteogenic mesenchyme of the frontal bone (35). After birth, Msx2 expression declines in the skull [reviewed in (10)]. Msx2 expression is continuous in both the epithelial and mesenchymal compartments of the molar and incisor tooth germs in the mouse (25;36). At the cap stage of tooth development, Msx2 expression is observed in the enamel navel, septum, and knot of the enamel organ as well as in the inner enamel epithelium (25;37). At the bell stage, during the differentiation of enamel epithelium to ameloblasts, Msx2 expression is lost from the inner enamel epithelium and strong expression is observed in the odontoblasts and the subondontoblastic regions of the dental papilla (25). In humans, the mandibular and maxillary bones, Meckle’s cartilage, and tooth germs express MSX2 (38). In the developing tooth germ, MSX2 is expressed in the vestibular lamina, dental epithelium, and the dental mesenchyme during the bud stage (39). MSX2 expression is lost in the dental mesenchyme later in development, but is observed in the enamel knot and vestibular epithelium of the cap stage tooth [reviewed in (10)].

Msx2 is expressed from the onset of limb bud outgrowth in both the ectoderm and mesoderm (40;41). Within the femur and tibia, Msx2 is expressed in resting and proliferative chondrocytes of the growth plate and articular cartilage, the perichondrium, and preosteoblasts and osteoblasts (3).

Msx2 is expressed in the atrioventricular (AV) endocardium, the cushion mesenchyme, subset of aortic adventitial myofibroblasts, valve fibrosal cells, a few endothelial cells of the aorta of the mouse fetus and adult, a subpopulation of vascular smooth muscle cells in brachial, femoral, and caudal arteries and veins, and the AV myocardium of the heart (30;42-44).

Msx2 expression is upregulated in mouse ovaries at the time of meiosis initiation (~E12.5-E13.5); Msx2 expression does not change in either fetal or post-natal testis upon male meiosis initiation (45). Msx2 is highly expressed in the female (ovarian) germ cell fraction compared with whole gonads (45). In human gonads, MSX2 expression is highly expressed in the fetal ovary during meiosis initiation at 14.5 weeks post-fertilization (45). Msx2 is expressed in the mouse female mammary gland during ductal development and early pregnancy, downregulated during late pregnancy and lactation, and re-induced during involution (46). 

In the eye, Msx2 is expressed in the optic vesicle as early as E9.5 (i.e., the lens placode stage) (4). At E10.5, Msx2 is expressed in the invaginating lens placode and weakly in the retina. At E11.5 (i.e., the lens vesicle stage), Msx2 is expressed at low levels in the epithelial cells and at moderate levels in the posterior portion of the optic vesicle (4). At E12.5, during primary lens fiber cell differentiation and elongation, Msx2 is moderately expressed throughout the primary lens fiber cells (4). In a transgenic mouse model that overexpressed Msx2, Msx2 was expressed in the ciliary marginal zone of the dorsal neural retina of the embryo as well as the optic vesicle (47).

Regulation

Several factors regulate Msx2 expression including retinoids, antisense ‘quenching’, growth factor regulation, hormones, and complementary/antagonistic interactions with other transcription factors (Table 1). 

Table 1. Select regulators of Msx2 expression.

Factor	Brief description	Details	References
BMP2 and BMP4	Members of the transforming growth factor-β family	Stimulates Msx2 expression in fetal gonads (BMP2 & BMP4)	(12;31;45;48-50)
YY1	Bi-functional zinc finger protein	Activates Msx2 in early mouse craniofacial and limb morphogenesis	(51)
FOXC1	Transcription factor; contains a DNA-binding forkhead domain	Activates Msx2 during the initial stages of osteoblast differentiation in axial and craniofacial development	(52)
Distal-less (Dlx) family members	Homeobox domain-containing transcription factor	Heterodimerizes with MSX2 to functionally antagonize MSX2 during craniofacial embryogenesis, including anterior neural tube formation	(53-55)
Estradiol and progesterone	Hormones	MSX2 expression can be either upregulated or downregulated by steroid hormone treatment in the mammary gland depending on the estrogen/progesterone receptor status and if the breast tissue sample was normal or malignant	(46;56-58)
1,25(OH)2D3	The active metabolite of vitamin D3 involved in adult mineral homeostasis and bone cell differentiation	Induces MSX2 expression in bone-derived cell cultures	(19)
Retinoic acid	Vitamin A derivative	Stimulates Msx2 expression in fetal gonads; regulates Msx2 in growth and differentiation of upper lip and primary plate morphogenesis in Xenopus laevis.	(45;59)
Tumor necrosis factor-α (TNF-α )	Cytokine (see the record for PanR1)	Upregulates Msx2 expression in aortic myofibroblasts; enhances Msx2 expression through NF-κB activation in vascular smooth muscle cells and C2C12 premyoblasts; Msx2 is also a target of TNFα in osteoblast differentiation	(60-62)

Background

MSX2 functions mainly as a transcriptional repressor in fetal development during dorsoventral patterning (63) as well as during development, growth, and differentiation in different tissues including the skull, hair follicles, limbs, teeth, heart, eye, mammary gland, and neural tube (2;3;10;17;21;27;31;37;39;47;64-67). Several targets of MSX2-associatied repression include transcriptional activators such as Dlx5, Dlx3, Runx2, and C/EBP-α (1;43;68-70). MSX2 controls the timing of cellular differentiation and proliferation to maintain cells in an undifferentiated, proliferative state (35;64;71). Overexpression of Msx2 inhibits differentiation (71) with a concomitant increase in proliferation (72).  For example, in a transgenic mouse that overexpressed Msx2, an increase in the number of proliferative osteoblasts in the osteogenic front was observed (64). In contrast, knockdown of Msx2 expression resulted in an increase in differentiation and a reduction in proliferation (72).

 

Several MSX2-associated functions are described in more detail, below.

Figure 6. Summary diagram for hair shaft differentiation and hair cycle regulators. (top) Several regulators and checkpoints mediate hair shaft differentiation at each transition (anagen-catagen, catagen-telogen, and telogen-anagen) of the hair cycle. (bottom) In hair shaft differentiation, induction of dermal papilla occurs and stem cells in the outer root sheath generate transit amplifying (TA) cells that migrate to the matrix region. Several molecular pathways are known to be involved in the specification and differentiation process. MSX2 is a central integrator that transmits growth factor signals to regulate hair differentiation. See the record for prune for more information on the hair follicle and cycle.

Hair, nail, and mammary gland development and homeostasis

Hair cycle regulation

The development of skin and its appendages (i.e., hair, nails, feathers, scales and mammary glands) requires interactions between the epidermis and the underlying mesenchyme (32). In particular, signaling during hair follicle induction involves fibroblast growth factor (Fgf; see the record for porcupine for information on Fgf5), sonic hedgehog (Shh), Bmp, and Msx genes (73-75). In addition, the oscillatory expression of diffusible growth factors and other molecules during the different phases of the hair cycle regulates the acceleration and/or arrest of the hair cycle [Figure 6; (2)]. See the record for prune for more information on the hair follicle and cycle. MSX2 expression is necessary for progression into the telogen phase of the hair cycle as well as for anagen re-entry (2). Transgenic mice that overexpress Msx2 exhibited retarded hair growth, a reduced hair matrix, desquamation, epidermal dysplasia, and hyperkeratosis [(21); reviewed in (76)]. Msx2 knockout (Msx2^-/-) mice exhibited repeated cycles of hair loss and regrowth (i.e., cyclic alopecia) (2;3). At P3, the Msx2^-/- mice exhibited retarded pelage hair growth and a thinner dermis compared to wild-type mice. By P5 the Msx2^-/- mice still had a thinner dermis as well as short, curly vibrissae and regions of hair follicles that were parallel to the muscle layer (2). At P10, hair follicles in the Msx2^-/- mice prematurely entered the catagen phase; wild-type hair follicles that still possessed hair follicles within the anagen phase (2). The Msx2^-/- mice have all four hair types (i.e., awl, auchene, guard, and zigzag), however, the hairs were short, wavy, and had an uneven diameter (2). At P14, the Msx2^-/- mice begin to lose their hair and exhibited patches of hairiness (typically around the snout and peri-orbital regions) (2;3). By P17, it was apparent that the Msx2^-/- skin exhibited a delay in catagen progression followed by a difficulty in re-entering the anagen phase (2). Over a three-month period, the Msx2^-/- mice exhibited two patterns of hair growth followed by alopecia (2). The hair from the Msx2^-/- mice was more easily removed than wild-type hairs and did not exhibit hair shaft breakage, indicating a premature entry into the exogen phase (2). In Msx2^-/- mice on the C57BL/6J genetic background, synthesis of the skin pigment melanin was also disturbed (2). The neural crest-derived melanocytes did not proliferate and mature, which typically occurs during the anagen phase (2;3). In addition, expression of Foxn1 and its target gene, the acidic hair keratin Ha3, were reduced in Msx2^-/- mice (1;2). Additional analysis determined that the expression of all known cortical keratins [see the records for Plush (Krt25), Polished (Krt33a), and Rough-fur (Krt10)] and several keratin-associated proteins were downregulated in the Msx2^-/- mice (1). Furthermore, it was determined that MSX2 and FOXN1 function downstream of BMP within the hair follicle and upstream of Notch1 during hair differentiation (1;77;78). Taken together, the BMP/MSX2/FOXN1/HA3 pathway is essential for hair shaft growth and differentiation as well as for the maintenance of cortical keratin expression during inner root sheath, cortex, and medulla differentiation within the hair matrix [Figure 6; (1)].

Nail differentiation and maintenance

MSX2 (and FOXN1, in a redundant role) also controls the expression of hard keratins (e.g., Krt33b and Krt86) within the nail plate to control the texture and thickness of nails (32). Msx2^-/- mice exhibited enlarged nail plates as well as more fragile hind limb nails than wild-type mice due to nail bed hyperplasia (3;32). Analysis of the nail matrix cells determined that the longer nails were not due to increased proliferation (32). The increased frequency of broken nails in the Msx2^-/- nails indicated that the nail plate was weakened (32). In addition, the expression of several keratins in the nails was reduced in the Msx2^-/- mice compared to wild-type mice and nail matrix-producing onychocytes in the keratogenous zone were poorly differentiated in the Msx2^-/- mice (32). 

Skin wound healing

During wound healing, MSX2 regulates re-epithelialization and keratinocyte differentiation. Msx2 expression was transiently upregulated in migrating and/or proliferating epidermal cells during skin wound healing in the mouse (34). Msx2^-/- keratinocytes migrated faster and collagen matrix contraction increased compared to those in wild-type mice after wounding, resulting in a more rapid wound closure in the Msx2^-/- mouse (34). 

Figure 7. MSX functions in epithelial-mesenchymal transition (EMT) during development. During development, delamination from the dorsal neural tube results in the generation of several cell types including odontoblasts, melanocytes, and the craniofacial bones and cartilage. EMT from mesodermal populations give rise to cells in the heart, bones, digestive tract and hematopoietic cells. (A) In heart development of the mouse, several signaling pathways ( e.g., TGF-β, BMP, Notch, and ERBB3 (alternatively, HER3)) converge to control EMT. The transcription factors Twist and Snail as well as the SMAD proteins, the HEY proteins, GATA4, and Fog are essential for EMT. MSX2 is regulated by BMP2 during EMT in the heart to subsuently regulate Twist expression. Protein structures were modeled after solved crystal structures, when available. ERBB3 (HER3), PDB: 1M6B ; Snail, PDB: 2Y48 ; GSK3-β, PDB: 1I09 ; GATA4: PDB: 2M9W . The figure depicts the role of MSX2 in heart development, but several of the factors are also involved in skull and mammary development. See the text for details. (B) EMT is the process by which epithelial cells lose their apico-basal polarity. Tight junctions dissolve allowing the mixing of apical and basolateral membrane proteins. Adherens and gap junctions are disassembled. Epithelial cells contain adherens junctions composed of E-cadherin, β-catenin, and actin. In tight junctions, integrins interact with components of the basement membrane. In EMT, the transcription of genes encoding components of the adherens and tight junctions are repressed by EMT inducers, leading to the loss of cell polarity. E-cadherin is degraded followed by breakdown of the basal membrane and apical constriction. Also, epithelial intermediate filaments, cytokeratins, are replaced by vimentin. During the final stages of EMT, the activation of metalloproteases and the expression integrin receptors favors migration through the extracellular matrix and invasion. Abbreviations: Erbb3 (HER3), v-erb-b2 erythroblastic leukemia viral oncogene homolog 3; Erbb3R, Erbb3 receptor; GSK3-β, glycogen synthase kinase 3 beta; ERK, extracellular-signal-regulated kinases; Fog2 (Zfpm2), zinc finger protein, multitype 2; GATA4, GATA binding protein 4; BMP-2, bone morphogenetic protein 2; TGF-β, transforming growth factor, beta; TGFβR, TGF-β receptor; SMAD2, SMAD family member 2

Mammary gland development and cancer

MSX2 also promotes the branching morphogenesis of mammary epithelium (3;27;57). Many Msx2^-/- female mice exhibited abnormal mammary development in that the mammary epithelium is arrested at the mammary sprout stage (3). During epithelial-mesenchymal transition (EMT; Figure 7) of mammary epithelial cells, there is an MSX2-mediated upregulation of Cripto1 expression, a member of the epithelial growth factor-CFC family involved in EMT-induction, migration, and invasion as well as activation of the c-Src pathway (5). In a mammary epithelial cell line, NMuMG, overexpression of Msx2 resulted in morphological (typical elongated and mesenchymal-like) and biochemical (decreased expression of the epithelial marker E-cadherin and increased expression of the mesenchymal markers, vimentin and N-cadherin) changes characteristics of EMT (5). In human breast carcinoma cells infiltrating into the adjacent stroma, there is an increase in MSX2 expression, compared to non-infiltrating tumor cells of the tumor (5).

Ovarian development

Msx2 expression correlates with meiosis initiation within ovarian germ cells in the female fetal gonad during early ovarian development; alteration of Msx2 expression does not alter male gonad development (45). MSX1 and MSX2 regulate the activation of STRA9, a factor required for meiosis (45).

Skeletal development

Craniofacial development

MSX2 functions in parallel to Twist, a target of the FGF and TGF pathways, in calvarial (skull) bone growth and suture fusion as well as in craniofacial bone mineralization. MSX2 controls the differentiation of the mesenchyme of the neural crest and mesoderm to skeletogenic mesenchyme as well as the proliferation of neural crest-derived skeletogenic mesenchyme cells (17;35;64;79-81). In contrast to its function in calvarial osteoblast mineralization, MSX2 prevents mineralization of ligament fibroblasts and the differentiation of the ligament fibroblasts to osteoblasts (82). The role of MSX2 in osteogenic differentiation to osteoblasts is unclear. Some studies have shown that MSX2 promotes osteogenic differentiation of skeletal progenitors by reducing the expression of dickkopf homolog 1 (Dkk1), an antagonist of LRP5 (see the record for r18) and LRP6, and subsequently enhancing Wnt signaling (43;83). In contrast, other studies have shown that MSX2 inhibits osteogenic differentiation through the repression of the expression of alkaline phosphatase (Alp) and osteogenic transcription factors such as Runx2, osteocalcin (alternatively, bone gamma carboxyglutamate protein (Bglap1)), Dlx3, and Dlx5 (55;69;80;84-88). A transgenic mouse overexpressing Msx2 exhibited overgrowth of the skull vault bones, a phenotype that mimics the early stages of craniosynostosis, a premature fusion of the calvarial bones at the sutures (64). Mice with a gain-of-function mutation within the homeobox domain (Msx2^Pro148His) also developed craniosynostosis (89;90). The Pro148His mutation resulted in increased binding affinity of MSX2 for target DNA, enhancing the function of MSX2 (91). Msx2^-/- mice exhibited calvarial foramina (i.e., defects in the ossification of bones of the skull) (3;35;65;92;93). In Msx2^-/- embryos, skeletogenic mesenchyme cells of the frontal bone anlagen were reduced and the frontal bones of P0 and P4 Msx2^-/- mice were thinner, and the osteogenic fronts smaller, than those of wild-type mice (3;35). At E18.5, Msx2^-/- mice had an enlarged anterior fontanel, indicating a delay in frontal bone ossification (80); the parietal fontanel of the Msx2^-/- mice was similar to the wild-type even though the interparietal and supraoccipital bones were smaller (3). Expression of early-stage osteoblast markers such as osteopontin (Opn), Alp, and Runx2 were reduced in frontal bone primordia of Msx2^-/- mice at E12.5 compared to wild-type controls (35). Msx1^-/-Msx2^-/- mice were deficient in calvarial ossification, resulting in the complete absence of the craniofacial bone [(3;80); reviewed in (10)].

Tooth development

MSX2 is also essential for normal alveolar process (alveolar bone) and tooth growth (39).  MSX2 functions in the repression of amelogenin (Amelx), a factor necessary for the development of enamel during tooth development, and subsequently controlling enamel thickness during enamel deposition (67). In Msx2^-/- mice, the incisor teeth were brittle and misaligned and the molars underwent severe degeneration (3). Tooth development was normal through the lamina, bud, and cap stages in Msx2^-/- mice (37). However, by E16.5, the volume of the enamel organ was reduced. By E17.5 the stellate reticulum (a group of cells within the center of the enamel organ) and stratum intermedium (the layer between the inner enamel epithelium and the cells of the stellate reticulum) were reduced, subsequently leading to progressive ameloblast degeneration after P1 (3). By P9, the ameloblast layer contained inflammatory cells and only a small amount of enamel had accumulated in the Msx2^-/- mice (3).  In another study, Aioub et al. noted a delay in molar eruption in Msx2^-/- mice as a result of defects in both cusp morphogenesis and enamel formation in the molars of the Msx2^-/- mice (37;39). Expression of Rank and Rankl, both markers of osteoclast differentiation, as well as Bmp4 were reduced in mandibles from Msx2^-/- mice (39). Bmp4 down-regulation in Msx2^-/- enamel knots resulted in defects in dental morphogenesis due to changes in the BMP4-dependent apoptosis pathway that controls silencing of the enamel knot (37). Furthermore, MSX2-associated downregulation of laminin3α5 and C/EBPα expression was essential for ameloblast differentiation and maintaining the cell adhesion complexes between adjacent ameloblasts and, subsequently, enamel matrix formation (37;39).

Limb development

MSX2 functions in skeletal morphogenesis by influencing mesenchymal cell fate towards proliferation and promoting differentiation into osteoblasts as well as by inhibiting adipocyte differentiation (39;43;83;92). The major function of MSX2 in limb development is to control apoptosis of the mesenchyme in the anterior apoptotic domain (94). MSX2 expression in the mesoderm along the anteroposterior axis is essential for the specification of digit number and identity through its involvement in both the Sonic hedgehog (Shh) and BMP signaling pathways (6). Msx2^-/- mice exhibited reduced axial and appendicular skeletal lengths as well as abnormal cartilage and endochondral bone formation at P30 (3). In addition, Msx2^-/- mice have decreased cancellous (i.e., spongy) bone and a reduced number of osteoblasts and chondrocytes at the epiphysis as well as reduced cortical bone thickness (3;43).

Chondrogenesis

MSX2 negatively regulates chondrocyte differentiation of migratory cranial neural crest cells without causing cell death (50;95;96). MSX2 controls chondrogenesis by stimulating endochondral ossification during chondrocyte maturation by physically associating with Smad1 to synergistically stimulate primary chondrocyte maturation and Indian hedgehog (Ihh) promoter activity at the hypertrophic and calcifying stage (50). Overexpression of MSX2 in primary chondrocytes stimulated BMP2-induced calcification and the expression of hypertrophic chondrocyte phenotypic markers as well as the differentiation of the chondrocytes into prehypertrohic or hypertrophic stages (50). Knockdown of Msx2 expression resulted in the inhibition of the maturation of primary chondrocytes (50); the numbers and cell sizes of resting, proliferative and hypertrophic chondrocytes were reduced (3).

Neural development

Hindbrain development

BMP4-induced Msx2 expression mediates the apoptotic removal of neural crest cells originating in rhomdomeres 3 and 5 to sculpt the neural crest cells exiting the dorsal aspects of the hindbrain (95;97-99). MSX2 and DLX5 function reciprocally through the regulation of ephrin-A5/EphA7 (see the records frog and turtle for more information about the ephrin receptors and ligands, respectively) expression during neural tube closure (54). Msx2^-/- mice exhibited seizure-like episodes between three weeks and two months of age (3). The number of cerebellar lobules and disorganization of the hemispheral and anterior vermal lobules was observed in the Msx2^-/- mice; no cerebral phenotype was identified (3). In the Msx2^-/- cerebellum, the vermis was hypoplastic and lacked a posterior lobule (3). In addition, lamination of the Purkinje cell and internal granule layers was deficient (3).

Eye development

MSX2 also functions in anterior segment development of the eye, including the timing of cell fate commitment and differentiation of retinal ganglion cells (4;100). Overexpression of Msx2 led to microphthalmia in transgenic mice due to changes in BMP-associated signaling and, subsequently, an increase in retinal cell death and a reduction in cell proliferation (47). Msx2^-/- mice exhibited varied lens and cornea deformities including corneal opacity and edema with microphthalmia as well as a smaller palpebral fissure (i.e., opening between the eye lids) (4). As early as E10.5, the optic vesicle in Msx2^-/- mice was larger, and the lens vesicle smaller, than wild-type mice (4). By E11.5, there was an obvious, abnormal expansion of the retinal pigment epithelium (RPE) in the Msx2^-/- mice (4). At E12.5, the cornea and lens were not separated in the Msx2^-/- mice and neural crest cells had migrated into the vitreous cavity and pushed the lens toward the cornea (4).  At E14.5, the anterior lens epithelium was multilayered, some lens fiber cells failed to be denucleated, abnormal mesenchyme filled the vitreous cavity, and the retina exhibited abnormal proliferation and folding, subsequently leading to shrinkage of the eye (4). In addition, there was only a single layer of cornea epithelium cell observed (4). Msx2^-/- mice at P21 had thickened cornea in the stromal layer, iridocorneal adhesion, iris hyperplasia, and smaller lens in the anterior segment compared to wild-type littermates (4). In addition, an overproliferated retina and mesenchyme tissues pushed the lens towards the cornea (4). Folding of the retina and ectopic pigmented tissue in the vitreous was also observed in the Msx2^-/- mice (4).

Heart development

MSX2 is essential for vascular mural cell (i.e., vascular smooth muscle cells and pericytes) formation as well as mural cell function in vessel remodeling (44). MSX2 and MSX1 function redundantly to upregulate NFATc1 expression in the atrioventricular (AV) endocardium as well as to maintain Notch1 and Bmp2/4 expression in the AV cushions during EMT in AV cushion and valve development [Figure 7; (66)]. Msx1^-/-Msx2^-/- mice exhibited hypoplastic AV cushions and shorter, thickened valves; single mutants were normal (66). In the Msx1^-/-Msx2^-/- mice the expression of Notch1, an inducer of EMT, was reduced in the AV cushions compared with the control (66). In addition, BMP2/4 signaling was decreased in the AV cushion mesenchyme as well as the atrial and ventricular myocardium of the Msx1^-/-Msx2^-/- mice (66).

Adipogenic differentiation

MSX2 also functions in the suppression of adipogenesis (43).  Suppression of adipogenesis is via antagonistic protein-protein interactions with C/EBPα and a subsequent reduction in PPARγ expression (43;83). In 3T3-L1 preadipocytes, TNFα-mediated induction of Msx2 expression activated the β-catenin/LEF/TCF complex to suppress adipocyte differentiation (101).

Human conditions associated with MSX2 mutations

Mutations in MSX2 are linked to type 2 craniosynostosis (alternatively, Boston-type craniosynostosis; OMIM: #604757), parietal foramina 1 (OMIM: #168500), and parietal foramina with cleidocranial dysplasia (OMIM: #168550) (90;92;102). Patients with craniosynostosis exhibit premature fusion of the calvarial bones of the skull at the sutures, while patients with parietal foramina exhibit defects in the ossification of bones of the skull (35). Without correction, craniosynostosis leads to skull deformity with a concomitant rise in intracranial pressure and possible neurodevelopmental disabilities. Patients with cleidocranial dysplasia exhibit persistently open skull sutures with bulging calvaria, hypoplasia, or aplasia of the clavicles, mammary hypoplasia, seizures, wide pubic symphysis, short middle phalanx of the fifth fingers, dental anomalies, and vertebral malformation.

Putative Mechanism

The phenotype observed in the duke mice mimics the cyclic alopecia (2) and microphthalmia (4) phenotypes observed in Msx2^-/- mice. In Msx2^-/- mice, a combination of the premature catagen onset as well as the cycling defects at the anagen-catagen, catagen-telogen, and telogen-anagen transitions results in the cyclic alopecia phenotype [Figure 6; (2;3)]. Loss of Msx2 expression either weakens the suppressive influences or enhances the positive influences at the anagen-catagen transition, subsequently facilitating catagen entry (2). The prolongation of catagen in the Msx2^-/- mice also suggests that Msx2 also functions in a positive role during the transition to telogen (2).

MSX2 may function parallel to, or downstream of, Ap2α and Pax6 in eye development (4). At E10.5-E11.5, FoxE3 expression was reduced in the invaginating lens vesicles of the Msx2^-/- mice, and by E12.5, FoxE3 was completely absent in the lens vesicles (49). The expression of Prox1 as well as both α- and β-crystallin (see the record for L1N) were overexpressed in the lens vesicles of the E11.5-E12.5 Msx2^-/- mice compared to wild-type mice, indicating premature initiation of lens differentiation (4). In addition, overexpression of Msx2, transiently repressed cyclin D1 in retinal progenitor cells (100). 

Primers

PCR Primer
duke_pcr_F: ATCCATCCTGGAGTCTGGTCCATC
duke_pcr_R: AGTTTCATGACCTCATTACTCACGCTG

Genotyping

Duke genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Duke(F): 5’- ATCCATCCTGGAGTCTGGTCCATC-3’

Duke(R): 5’- AGTTTCATGACCTCATTACTCACGCTG-3’

Sequencing Primer

Duke_seq(F): 5’- CTTCCTTAGGATAGATGGTACATGC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 707 nucleotides is amplified (Chr.13: 53468136-53468842, GRCm38; NC_000079):

atccatcctg gagtctggtc catctggtct tccttaggat agatggtaca tgccatatcc

aaccggcgtg gcatagagtc caacaggcgg gatggggagc acaggtctat ggaaggggta

ggatgcgccg tatatggatg ctgcttgcag gggtgagttg atagggaagg gcagactgaa

gcctgagggc agcataggct tggcagccat tttcagcttt tccagttccg cctcttgcag

tcttttcgcc ttagcccttc ggttctggaa ccagattttg acctgggtct ctgtaaggtt

cagagagctg gagaactcgg cccgctctgc tatggacagg tactgtttct ggcggaactt

gcgctccaag gctagaagct gggatgtggt gaagggtgtg cgtggcttcc ggttggtctt

gtgtttcctc agggtgcagg tggtggggct catatgtcct agaggacaga gagggaaatc

aattagtgaa ttttgtaatc tcttccctct taagaacaca tagactttgt ttcattttta

aaaaggaggt acctttgtca aatctgtgag tgtgtgtgtg tgtgtgtgtg tgtgtgtgtg

tgtgtgtgtg tgtgtgtgag aagtagtcag ttatgaaaaa ggaccacatt taaatggtag

gtagttgctg tattttatat cagcgtgagt aatgaggtca tgaaact

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (C>A, Chr. (+) strand; G>T, sense strand).

References

  1. Cai, J., Lee, J., Kopan, R., and Ma, L. (2009) Genetic Interplays between Msx2 and Foxn1 are Required for Notch1 Expression and Hair Shaft Differentiation. Dev Biol. 326, 420-430.

  2. Ma, L., Liu, J., Wu, T., Plikus, M., Jiang, T. X., Bi, Q., Liu, Y. H., Muller-Rover, S., Peters, H., Sundberg, J. P., Maxson, R., Maas, R. L., and Chuong, C. M. (2003) 'Cyclic Alopecia' in Msx2 Mutants: Defects in Hair Cycling and Hair Shaft Differentiation. Development. 130, 379-389.

  3. Satokata, I., Ma, L., Ohshima, H., Bei, M., Woo, I., Nishizawa, K., Maeda, T., Takano, Y., Uchiyama, M., Heaney, S., Peters, H., Tang, Z., Maxson, R., and Maas, R. (2000) Msx2 Deficiency in Mice Causes Pleiotropic Defects in Bone Growth and Ectodermal Organ Formation. Nat Genet. 24, 391-395.

  4. Zhao, J., Kawai, K., Wang, H., Wu, D., Wang, M., Yue, Z., Zhang, J., and Liu, Y. H. (2012) Loss of Msx2 Function Down-Regulates the FoxE3 Expression and Results in Anterior Segment Dysgenesis Resembling Peters Anomaly. Am J Pathol. 180, 2230-2239.

  5. di Bari, M. G., Ginsburg, E., Plant, J., Strizzi, L., Salomon, D. S., and Vonderhaar, B. K. (2009) Msx2 Induces Epithelial-Mesenchymal Transition in Mouse Mammary Epithelial Cells through Upregulation of Cripto-1. J Cell Physiol. 219, 659-666.

  6. Bensoussan-Trigano, V., Lallemand, Y., Saint Cloment, C., and Robert, B. (2011) Msx1 and Msx2 in Limb Mesenchyme Modulate Digit Number and Identity. Dev Dyn. 240, 1190-1202.

  7. Davidson, D. (1995) The Function and Evolution of Msx Genes: Pointers and Paradoxes. Trends Genet. 11, 405-411.

  8. Catron, K. M., Wang, H., Hu, G., Shen, M. M., and Abate-Shen, C. (1996) Comparison of MSX-1 and MSX-2 Suggests a Molecular Basis for Functional Redundancy. Mech Dev. 55, 185-199.

  9. Holland, P. W. (1991) Cloning and Evolutionary Analysis of Msh-Like Homeobox Genes from Mouse, Zebrafish and Ascidian. Gene. 98, 253-257.

  10. Alappat, S., Zhang, Z. Y., and Chen, Y. P. (2003) Msx Homeobox Gene Family and Craniofacial Development. Cell Res. 13, 429-442.

  11. Brugger, S. M., Merrill, A. E., Torres-Vazquez, J., Wu, N., Ting, M. C., Cho, J. Y., Dobias, S. L., Yi, S. E., Lyons, K., Bell, J. R., Arora, K., Warrior, R., and Maxson, R. (2004) A Phylogenetically Conserved Cis-Regulatory Module in the Msx2 Promoter is Sufficient for BMP-Dependent Transcription in Murine and Drosophila Embryos. Development. 131, 5153-5165.

  12. Bei, M., and Maas, R. (1998) FGFs and BMP4 Induce both Msx1-Independent and Msx1-Dependent Signaling Pathways in Early Tooth Development. Development. 125, 4325-4333.

  13. Lallemand, Y., Nicola, M. A., Ramos, C., Bach, A., Cloment, C. S., and Robert, B. (2005) Analysis of Msx1; Msx2 Double Mutants Reveals Multiple Roles for Msx Genes in Limb Development. Development. 132, 3003-3014.

  14. Hovde, S., Abate-Shen, C., and Geiger, J. H. (2001) Crystal Structure of the Msx-1 homeodomain/DNA Complex. Biochemistry. 40, 12013-12021.

  15. Newberry, E. P., Latifi, T., Battaile, J. T., and Towler, D. A. (1997) Structure-Function Analysis of Msx2-Mediated Transcriptional Suppression. Biochemistry. 36, 10451-10462.

  16. Catron, K. M., Zhang, H., Marshall, S. C., Inostroza, J. A., Wilson, J. M., and Abate, C. (1995) Transcriptional Repression by Msx-1 does Not Require Homeodomain DNA-Binding Sites. Mol Cell Biol. 15, 861-871.

  17. Cheng, S. L., Shao, J. S., Cai, J., Sierra, O. L., and Towler, D. A. (2008) Msx2 Exerts Bone Anabolism Via Canonical Wnt Signaling. J Biol Chem. 283, 20505-20522.

  18. Jeong, H. M., Jin, Y. H., Choi, Y. H., Yum, J., Choi, J. K., Yeo, C. Y., and Lee, K. Y. (2012) PKC Signaling Inhibits Osteogenic Differentiation through the Regulation of Msx2 Function. Biochim Biophys Acta. 1823, 1225-1232.

  19. Hodgkinson, J. E., Davidson, C. L., Beresford, J., and Sharpe, P. T. (1993) Expression of a Human Homeobox-Containing Gene is Regulated by 1,25(OH)2D3 in Bone Cells. Biochim Biophys Acta. 1174, 11-16.

  20. Genc, B., Ma, L., and Erzurumlu, R. S. (2001) Whisker-Related Neural Patterns Develop Normally Despite Severe Whisker Defects in Msx2 Knockout Mice. Brain Res Dev Brain Res. 132, 107-111.

  21. Jiang, T. X., Liu, Y. H., Widelitz, R. B., Kundu, R. K., Maxson, R. E., and Chuong, C. M. (1999) Epidermal Dysplasia and Abnormal Hair Follicles in Transgenic Mice Overexpressing Homeobox Gene MSX-2. J Invest Dermatol. 113, 230-237.

  22. Foerst-Potts, L., and Sadler, T. W. (1997) Disruption of Msx-1 and Msx-2 Reveals Roles for these Genes in Craniofacial, Eye, and Axial Development. Dev Dyn. 209, 70-84.

  23. Hill, R. E., Jones, P. F., Rees, A. R., Sime, C. M., Justice, M. J., Copeland, N. G., Jenkins, N. A., Graham, E., and Davidson, D. R. (1989) A New Family of Mouse Homeo Box-Containing Genes: Molecular Structure, Chromosomal Location, and Developmental Expression of Hox-7.1. Genes Dev. 3, 26-37.

  24. Liu, Y. H., Ma, L., Wu, L. Y., Luo, W., Kundu, R., Sangiorgi, F., Snead, M. L., and Maxson, R. (1994) Regulation of the Msx2 Homeobox Gene during Mouse Embryogenesis: A Transgene with 439 Bp of 5' Flanking Sequence is Expressed Exclusively in the Apical Ectodermal Ridge of the Developing Limb. Mech Dev. 48, 187-197.

  25. MacKenzie, A., Ferguson, M. W., and Sharpe, P. T. (1992) Expression Patterns of the Homeobox Gene, Hox-8, in the Mouse Embryo Suggest a Role in Specifying Tooth Initiation and Shape. Development. 115, 403-420.

  26. Mackenzie, A., Leeming, G. L., Jowett, A. K., Ferguson, M. W., and Sharpe, P. T. (1991) The Homeobox Gene Hox 7.1 has Specific Regional and Temporal Expression Patterns during Early Murine Craniofacial Embryogenesis, especially Tooth Development in Vivo and in Vitro. Development. 111, 269-285.

  27. Satoh, K., Ginsburg, E., and Vonderhaar, B. K. (2004) Msx-1 and Msx-2 in Mammary Gland Development. J Mammary Gland Biol Neoplasia. 9, 195-205.

  28. Bendall, A. J., and Abate-Shen, C. (2000) Roles for Msx and Dlx Homeoproteins in Vertebrate Development. Gene. 247, 17-31.

  29. Monaghan, A. P., Davidson, D. R., Sime, C., Graham, E., Baldock, R., Bhattacharya, S. S., and Hill, R. E. (1991) The Msh-Like Homeobox Genes Define Domains in the Developing Vertebrate Eye. Development. 112, 1053-1061.

  30. Chan-Thomas, P. S., Thompson, R. P., Robert, B., Yacoub, M. H., and Barton, P. J. (1993) Expression of Homeobox Genes Msx-1 (Hox-7) and Msx-2 (Hox-8) during Cardiac Development in the Chick. Dev Dyn. 197, 203-216.

  31. Ramos, C., and Robert, B. (2005) Msh/Msx Gene Family in Neural Development. Trends Genet. 21, 624-632.

  32. Cai, J., and Ma, L. (2011) Msx2 and Foxn1 Regulate Nail Homeostasis. Genesis. 49, 449-459.

  33. Han, M., Yang, X., Farrington, J. E., and Muneoka, K. (2003) Digit Regeneration is Regulated by Msx1 and BMP4 in Fetal Mice. Development. 130, 5123-5132.

  34. Yeh, J., Green, L. M., Jiang, T. X., Plikus, M., Huang, E., Chang, R. N., Hughes, M. W., Chuong, C. M., and Tuan, T. L. (2009) Accelerated Closure of Skin Wounds in Mice Deficient in the Homeobox Gene Msx2. Wound Repair Regen. 17, 639-648.

  35. Ishii, M., Merrill, A. E., Chan, Y. S., Gitelman, I., Rice, D. P., Sucov, H. M., and Maxson, R. E.,Jr. (2003) Msx2 and Twist Cooperatively Control the Development of the Neural Crest-Derived Skeletogenic Mesenchyme of the Murine Skull Vault. Development. 130, 6131-6142.

  36. Tureckova, J., Sahlberg, C., Aberg, T., Ruch, J. V., Thesleff, I., and Peterkova, R. (1995) Comparison of Expression of the Msx-1, Msx-2, BMP-2 and BMP-4 Genes in the Mouse Upper Diastemal and Molar Tooth Primordia. Int J Dev Biol. 39, 459-468.

  37. Bei, M., Stowell, S., and Maas, R. (2004) Msx2 Controls Ameloblast Terminal Differentiation. Dev Dyn. 231, 758-765.

  38. Davideau, J. L., Demri, P., Hotton, D., Gu, T. T., MacDougall, M., Sharpe, P., Forest, N., and Berdal, A. (1999) Comparative Study of MSX-2, DLX-5, and DLX-7 Gene Expression during Early Human Tooth Development. Pediatr Res. 46, 650-656.

  39. Aioub, M., Lezot, F., Molla, M., Castaneda, B., Robert, B., Goubin, G., Nefussi, J. R., and Berdal, A. (2007) Msx2 -/- Transgenic Mice Develop Compound Amelogenesis Imperfecta, Dentinogenesis Imperfecta and Periodental Osteopetrosis. Bone. 41, 851-859.

  40. Davidson, D. R., Crawley, A., Hill, R. E., and Tickle, C. (1991) Position-Dependent Expression of Two Related Homeobox Genes in Developing Vertebrate Limbs. Nature. 352, 429-431.

  41. Robert, B., Lyons, G., Simandl, B. K., Kuroiwa, A., and Buckingham, M. (1991) The Apical Ectodermal Ridge Regulates Hox-7 and Hox-8 Gene Expression in Developing Chick Limb Buds. Genes Dev. 5, 2363-2374.

  42. Abdelwahid, E., Rice, D., Pelliniemi, L. J., and Jokinen, E. (2001) Overlapping and Differential Localization of Bmp-2, Bmp-4, Msx-2 and Apoptosis in the Endocardial Cushion and Adjacent Tissues of the Developing Mouse Heart. Cell Tissue Res. 305, 67-78.

  43. Cheng, S. L., Shao, J. S., Charlton-Kachigian, N., Loewy, A. P., and Towler, D. A. (2003) MSX2 Promotes Osteogenesis and Suppresses Adipogenic Differentiation of Multipotent Mesenchymal Progenitors. J Biol Chem. 278, 45969-45977.

  44. Goupille, O., Saint Cloment, C., Lopes, M., Montarras, D., and Robert, B. (2008) Msx1 and Msx2 are Expressed in Sub-Populations of Vascular Smooth Muscle Cells. Dev Dyn. 237, 2187-2194.

  45. Le Bouffant, R., Souquet, B., Duval, N., Duquenne, C., Herve, R., Frydman, N., Robert, B., Habert, R., and Livera, G. (2011) Msx1 and Msx2 Promote Meiosis Initiation. Development. 138, 5393-5402.

  46. Phippard, D. J., Weber-Hall, S. J., Sharpe, P. T., Naylor, M. S., Jayatalake, H., Maas, R., Woo, I., Roberts-Clark, D., Francis-West, P. H., Liu, Y. H., Maxson, R., Hill, R. E., and Dale, T. C. (1996) Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during Foetal and Postnatal Mammary Gland Development. Development. 122, 2729-2737.

  47. Wu, L. Y., Li, M., Hinton, D. R., Guo, L., Jiang, S., Wang, J. T., Zeng, A., Xie, J. B., Snead, M., Shuler, C., Maxson, R. E.,Jr, and Liu, Y. H. (2003) Microphthalmia Resulting from MSX2-Induced Apoptosis in the Optic Vesicle. Invest Ophthalmol Vis Sci. 44, 2404-2412.

  48. Furuta, Y., Piston, D. W., and Hogan, B. L. (1997) Bone Morphogenetic Proteins (BMPs) as Regulators of Dorsal Forebrain Development. Development. 124, 2203-2212.

  49. Pizette, S., and Niswander, L. (1999) BMPs Negatively Regulate Structure and Function of the Limb Apical Ectodermal Ridge. Development. 126, 883-894.

  50. Amano, K., Ichida, F., Sugita, A., Hata, K., Wada, M., Takigawa, Y., Nakanishi, M., Kogo, M., Nishimura, R., and Yoneda, T. (2008) MSX2 Stimulates Chondrocyte Maturation by Controlling Ihh Expression. J Biol Chem. 283, 29513-29521.

  51. Tan, D. P., Nonaka, K., Nuckolls, G. H., Liu, Y. H., Maxson, R. E., Slavkin, H. C., and Shum, L. (2002) YY1 Activates Msx2 Gene Independent of Bone Morphogenetic Protein Signaling. Nucleic Acids Res. 30, 1213-1223.

  52. Mirzayans, F., Lavy, R., Penner-Chea, J., and Berry, F. B. (2012) Initiation of Early Osteoblast Differentiation Events through the Direct Transcriptional Regulation of Msx2 by FOXC1. PLoS One. 7, e49095.

  53. Zhang, H., Hu, G., Wang, H., Sciavolino, P., Iler, N., Shen, M. M., and Abate-Shen, C. (1997) Heterodimerization of Msx and Dlx Homeoproteins Results in Functional Antagonism. Mol Cell Biol. 17, 2920-2932.

  54. Lee, J., Corcoran, A., Han, M., Gardiner, D. M., and Muneoka, K. (2013) Dlx5 and Msx2 Regulate Mouse Anterior Neural Tube Closure through ephrinA5-EphA7. Dev Growth Differ. 55, 341-349.

  55. Newberry, E. P., Latifi, T., and Towler, D. A. (1998) Reciprocal Regulation of Osteocalcin Transcription by the Homeodomain Proteins Msx2 and Dlx5. Biochemistry. 37, 16360-16368.

  56. Friedmann, Y., and Daniel, C. W. (1996) Regulated Expression of Homeobox Genes Msx-1 and Msx-2 in Mouse Mammary Gland Development Suggests a Role in Hormone Action and Epithelial-Stromal Interactions. Dev Biol. 177, 347-355.

  57. Satoh, K., Hovey, R. C., Malewski, T., Warri, A., Goldhar, A. S., Ginsburg, E., Saito, K., Lydon, J. P., and Vonderhaar, B. K. (2007) Progesterone Enhances Branching Morphogenesis in the Mouse Mammary Gland by Increased Expression of Msx2. Oncogene. 26, 7526-7534.

  58. Malewski, T., Milewicz, T., Krzysiek, J., Gregoraszczuk, E. L., and Augustowska, K. (2005) Regulation of Msx2 Gene Expression by Steroid Hormones in Human Nonmalignant and Malignant Breast Cancer Explants Cultured in Vitro. Cancer Invest. 23, 222-228.

  59. Kennedy, A. E., and Dickinson, A. J. (2012) Median Facial Clefts in Xenopus Laevis: Roles of Retinoic Acid Signaling and Homeobox Genes. Dev Biol. 365, 229-240.

  60. Al-Aly, Z., Shao, J. S., Lai, C. F., Huang, E., Cai, J., Behrmann, A., Cheng, S. L., and Towler, D. A. (2007) Aortic Msx2-Wnt Calcification Cascade is Regulated by TNF-Alpha-Dependent Signals in Diabetic Ldlr-/- Mice. Arterioscler Thromb Vasc Biol. 27, 2589-2596.

  61. Lee, H. L., Yi, T., Woo, K. M., Ryoo, H. M., Kim, G. S., and Baek, J. H. (2010) Msx2 Mediates the Inhibitory Action of TNF-Alpha on Osteoblast Differentiation. Exp Mol Med. 42, 437-445.

  62. Lee, H. L., Woo, K. M., Ryoo, H. M., and Baek, J. H. (2010) Tumor Necrosis Factor-Alpha Increases Alkaline Phosphatase Expression in Vascular Smooth Muscle Cells Via MSX2 Induction. Biochem Biophys Res Commun. 391, 1087-1092.

  63. Onitsuka, I., Takeda, M., and Maeno, M. (2000) Expression and Function of Xmsx-2B in Dorso-Ventral Axis Formation in Gastrula Embryos. Zoolog Sci. 17, 1107-1113.

  64. Liu, Y. H., Tang, Z., Kundu, R. K., Wu, L., Luo, W., Zhu, D., Sangiorgi, F., Snead, M. L., and Maxson, R. E. (1999) Msx2 Gene Dosage Influences the Number of Proliferative Osteogenic Cells in Growth Centers of the Developing Murine Skull: A Possible Mechanism for MSX2-Mediated Craniosynostosis in Humans. Dev Biol. 205, 260-274.

  65. Liu, Y. H., Kundu, R., Wu, L., Luo, W., Ignelzi, M. A.,Jr, Snead, M. L., and Maxson, R. E.,Jr. (1995) Premature Suture Closure and Ectopic Cranial Bone in Mice Expressing Msx2 Transgenes in the Developing Skull. Proc Natl Acad Sci U S A. 92, 6137-6141.

  66. Chen, Y. H., Ishii, M., Sucov, H. M., and Maxson, R. E.,Jr. (2008) Msx1 and Msx2 are Required for Endothelial-Mesenchymal Transformation of the Atrioventricular Cushions and Patterning of the Atrioventricular Myocardium. BMC Dev Biol. 8, 75-213X-8-75.

  67. Molla, M., Descroix, V., Aioub, M., Simon, S., Castaneda, B., Hotton, D., Bolanos, A., Simon, Y., Lezot, F., Goubin, G., and Berdal, A. (2010) Enamel Protein Regulation and Dental and Periodontal Physiopathology in MSX2 Mutant Mice. Am J Pathol. 177, 2516-2526.

  68. Zhou, Y. L., Lei, Y., and Snead, M. L. (2000) Functional Antagonism between Msx2 and CCAAT/enhancer-Binding Protein Alpha in Regulating the Mouse Amelogenin Gene Expression is Mediated by Protein-Protein Interaction. J Biol Chem. 275, 29066-29075.

  69. Shirakabe, K., Terasawa, K., Miyama, K., Shibuya, H., and Nishida, E. (2001) Regulation of the Activity of the Transcription Factor Runx2 by Two Homeobox Proteins, Msx2 and Dlx5. Genes Cells. 6, 851-856.

  70. Sierra, O. L., Cheng, S. L., Loewy, A. P., Charlton-Kachigian, N., and Towler, D. A. (2004) MINT, the Msx2 Interacting Nuclear Matrix Target, Enhances Runx2-Dependent Activation of the Osteocalcin Fibroblast Growth Factor Response Element. J Biol Chem. 279, 32913-32923.

  71. Hu, G., Lee, H., Price, S. M., Shen, M. M., and Abate-Shen, C. (2001) Msx Homeobox Genes Inhibit Differentiation through Upregulation of Cyclin D1. Development. 128, 2373-2384.

  72. Dodig, M., Tadic, T., Kronenberg, M. S., Dacic, S., Liu, Y. H., Maxson, R., Rowe, D. W., and Lichtler, A. C. (1999) Ectopic Msx2 Overexpression Inhibits and Msx2 Antisense Stimulates Calvarial Osteoblast Differentiation. Dev Biol. 209, 298-307.

  73. Chuong, C. M., Widelitz, R. B., Ting-Berreth, S., and Jiang, T. X. (1996) Early Events during Avian Skin Appendage Regeneration: Dependence on Epithelial-Mesenchymal Interaction and Order of Molecular Reappearance. J Invest Dermatol. 107, 639-646.

  74. Oro, A. E., and Scott, M. P. (1998) Splitting Hairs: Dissecting Roles of Signaling Systems in Epidermal Development. Cell. 95, 575-578.

  75. Widelitz, R. B., and Chuong, C. M. (1999) Early Events in Skin Appendage Formation: Induction of Epithelial Placodes and Condensation of Dermal Mesenchyme. J Investig Dermatol Symp Proc. 4, 302-306.

  76. Wang, W. P., Widelitz, R. B., Jiang, T. X., and Chuong, C. M. (1999) Msx-2 and the Regulation of Organ Size: Epidermal Thickness and Hair Length. J Investig Dermatol Symp Proc. 4, 278-281.

  77. Andl, T., Ahn, K., Kairo, A., Chu, E. Y., Wine-Lee, L., Reddy, S. T., Croft, N. J., Cebra-Thomas, J. A., Metzger, D., Chambon, P., Lyons, K. M., Mishina, Y., Seykora, J. T., Crenshaw, E. B.,3rd, and Millar, S. E. (2004) Epithelial Bmpr1a Regulates Differentiation and Proliferation in Postnatal Hair Follicles and is Essential for Tooth Development. Development. 131, 2257-2268.

  78. Kulessa, H., Turk, G., and Hogan, B. L. (2000) Inhibition of Bmp Signaling Affects Growth and Differentiation in the Anagen Hair Follicle. EMBO J. 19, 6664-6674.

  79. Yoon, W. J., Cho, Y. D., Cho, K. H., Woo, K. M., Baek, J. H., Cho, J. Y., Kim, G. S., and Ryoo, H. M. (2008) The Boston-Type Craniosynostosis Mutation MSX2 (P148H) Results in Enhanced Susceptibility of MSX2 to Ubiquitin-Dependent Degradation. J Biol Chem. 283, 32751-32761.

  80. Han, J., Ishii, M., Bringas Jr., P., Maas, R. L., Maxson Jr., R. E., and Chai, Y. (2007) Concerted Action of Msx1 and Msx2 in Regulating Cranial Neural Crest Cell Differentiation during Frontal Bone Development. Mech Dev. 124, 729-745.

  81. Hosokawa, R., Urata, M., Han, J., Zehnaly, A., Bringas, P.,Jr, Nonaka, K., and Chai, Y. (2007) TGF-Beta Mediated Msx2 Expression Controls Occipital Somites-Derived Caudal Region of Skull Development. Dev Biol. 310, 140-153.

  82. Yoshizawa, T., Takizawa, F., Iizawa, F., Ishibashi, O., Kawashima, H., Matsuda, A., Endo, N., and Kawashima, H. (2004) Homeobox Protein MSX2 Acts as a Molecular Defense Mechanism for Preventing Ossification in Ligament Fibroblasts. Mol Cell Biol. 24, 3460-3472.

  83. Ichida, F., Nishimura, R., Hata, K., Matsubara, T., Ikeda, F., Hisada, K., Yatani, H., Cao, X., Komori, T., Yamaguchi, A., and Yoneda, T. (2004) Reciprocal Roles of MSX2 in Regulation of Osteoblast and Adipocyte Differentiation. J Biol Chem. 279, 34015-34022.

  84. Hoffmann, H. M., Catron, K. M., van Wijnen, A. J., McCabe, L. R., Lian, J. B., Stein, G. S., and Stein, J. L. (1994) Transcriptional Control of the Tissue-Specific, Developmentally Regulated Osteocalcin Gene Requires a Binding Motif for the Msx Family of Homeodomain Proteins. Proc Natl Acad Sci U S A. 91, 12887-12891.

  85. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994) Msx-2/Hox 8.1: A Transcriptional Regulator of the Rat Osteocalcin Promoter. Mol Endocrinol. 8, 1484-1493.

  86. Kim, Y. J., Lee, M. H., Wozney, J. M., Cho, J. Y., and Ryoo, H. M. (2004) Bone Morphogenetic Protein-2-Induced Alkaline Phosphatase Expression is Stimulated by Dlx5 and Repressed by Msx2. J Biol Chem. 279, 50773-50780.

  87. Newberry, E. P., Boudreaux, J. M., and Towler, D. A. (1997) Stimulus-Selective Inhibition of Rat Osteocalcin Promoter Induction and Protein-DNA Interactions by the Homeodomain Repressor Msx2. J Biol Chem. 272, 29607-29613.

  88. Hassan, M. Q., Javed, A., Morasso, M. I., Karlin, J., Montecino, M., van Wijnen, A. J., Stein, G. S., Stein, J. L., and Lian, J. B. (2004) Dlx3 Transcriptional Regulation of Osteoblast Differentiation: Temporal Recruitment of Msx2, Dlx3, and Dlx5 Homeodomain Proteins to Chromatin of the Osteocalcin Gene. Mol Cell Biol. 24, 9248-9261.

  89. Winograd, J., Reilly, M. P., Roe, R., Lutz, J., Laughner, E., Xu, X., Hu, L., Asakura, T., vander Kolk, C., Strandberg, J. D., and Semenza, G. L. (1997) Perinatal Lethality and Multiple Craniofacial Malformations in MSX2 Transgenic Mice. Hum Mol Genet. 6, 369-379.

  90. Jabs, E. W., Muller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, I., Sparkes, R., Warman, M. L., and Mulliken, J. B. (1993) A Mutation in the Homeodomain of the Human MSX2 Gene in a Family Affected with Autosomal Dominant Craniosynostosis. Cell. 75, 443-450.

  91. Ma, L., Golden, S., Wu, L., and Maxson, R. (1996) The Molecular Basis of Boston-Type Craniosynostosis: The Pro148-->His Mutation in the N-Terminal Arm of the MSX2 Homeodomain Stabilizes DNA Binding without Altering Nucleotide Sequence Preferences. Hum Mol Genet. 5, 1915-1920.

  92. Wilkie, A. O., Tang, Z., Elanko, N., Walsh, S., Twigg, S. R., Hurst, J. A., Wall, S. A., Chrzanowska, K. H., and Maxson, R. E.,Jr. (2000) Functional Haploinsufficiency of the Human Homeobox Gene MSX2 Causes Defects in Skull Ossification. Nat Genet. 24, 387-390.

  93. Wuyts, W., Reardon, W., Preis, S., Homfray, T., Rasore-Quartino, A., Christians, H., Willems, P. J., and Van Hul, W. (2000) Identification of Mutations in the MSX2 Homeobox Gene in Families Affected with Foramina Parietalia Permagna. Hum Mol Genet. 9, 1251-1255.

  94. Lallemand, Y., Bensoussan, V., Cloment, C. S., and Robert, B. (2009) Msx Genes are Important Apoptosis Effectors Downstream of the Shh/Gli3 Pathway in the Limb. Dev Biol. 331, 189-198.

  95. Takahashi, K., Nuckolls, G. H., Tanaka, O., Semba, I., Takahashi, I., Dashner, R., Shum, L., and Slavkin, H. C. (1998) Adenovirus-Mediated Ectopic Expression of Msx2 in Even-Numbered Rhombomeres Induces Apoptotic Elimination of Cranial Neural Crest Cells in Ovo. Development. 125, 1627-1635.

  96. Semba, I., Nonaka, K., Takahashi, I., Takahashi, K., Dashner, R., Shum, L., Nuckolls, G. H., and Slavkin, H. C. (2000) Positionally-Dependent Chondrogenesis Induced by BMP4 is Co-Regulated by Sox9 and Msx2. Dev Dyn. 217, 401-414.

  97. Graham, A., Koentges, G., and Lumsden, A. (1996) Neural Crest Apoptosis and the Establishment of Craniofacial Pattern: An Honorable Death. Mol Cell Neurosci. 8, 76-83.

  98. Graham, A., Francis-West, P., Brickell, P., and Lumsden, A. (1994) The Signalling Molecule BMP4 Mediates Apoptosis in the Rhombencephalic Neural Crest. Nature. 372, 684-686.

  99. Farlie, P. G., Kerr, R., Thomas, P., Symes, T., Minichiello, J., Hearn, C. J., and Newgreen, D. (1999) A Paraxial Exclusion Zone Creates Patterned Cranial Neural Crest Cell Outgrowth Adjacent to Rhombomeres 3 and 5. Dev Biol. 213, 70-84.

  100. Jiang, S. Y., and Wang, J. T. (2010) Msx2 Alters the Timing of Retinal Ganglion Cells Fate Commitment and Differentiation. Biochem Biophys Res Commun. 395, 524-529.

  101. Qadir, A. S., Lee, H. L., Baek, K. H., Park, H. J., Woo, K. M., Ryoo, H. M., and Baek, J. H. (2011) Msx2 is Required for TNF-Alpha-Induced Canonical Wnt Signaling in 3T3-L1 Preadipocytes. Biochem Biophys Res Commun. 408, 399-404.

  102. Suda, N., Kitahara, Y., and Ohyama, K. (2006) A Case of Amelogenesis Imperfecta, Cleft Lip and Palate and Polycystic Kidney Disease. Orthod Craniofac Res. 9, 52-56.