Phenotypic Mutation 'gus-gus' (pdf version)
List [record 1 of 1]
Allelegus-gus
Mutation Type missense
Chromosome14
Coordinate103,820,013 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Ednrb
Gene Name endothelin receptor type B
Synonym(s) ETb, ETR-b, Sox10m1
Chromosomal Location 103,814,625-103,844,402 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007904.4, NM_001276296.1, NM_001136061.2; MGI: 102720

Mapped Yes 
Amino Acid Change Glycine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022718] [ENSMUSP00000126057] [ENSMUSP00000154806]
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: G371D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000022718)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: G371D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000172237)
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000227824)
Phenotypic Category
Phenotypequestion? Literature verified References
lethality-postnatal 17246828
pigmentation 17246828
skin/coat/nails 17246828
Penetrance  
Alleles Listed at MGI

All alleles(45) : Targeted(10) Spontaneous(3) Chemically induced(14) Radiation induced(20)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 103820019 missense probably damaging 1.00
IGL01433:Ednrb APN 14 103843190 missense probably damaging 0.98
IGL01631:Ednrb APN 14 103843225 missense probably benign 0.02
IGL01696:Ednrb APN 14 103823189 missense probably benign 0.00
IGL01974:Ednrb APN 14 103820818 missense probably damaging 1.00
IGL02749:Ednrb APN 14 103823059 missense possibly damaging 0.63
IGL03277:Ednrb APN 14 103843299 missense probably benign 0.00
pongo UTSW 14 103823274 splice acceptor site probably null
sposh UTSW 14 103821714 missense probably damaging 0.97
R0284:Ednrb UTSW 14 103820013 missense probably damaging 1.00
R0591:Ednrb UTSW 14 103823274 splice site probably null
R2072:Ednrb UTSW 14 103817099 missense probably benign 0.27
R2080:Ednrb UTSW 14 103843100 missense probably damaging 1.00
R2102:Ednrb UTSW 14 103820914 nonsense probably null
R2118:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2119:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2124:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2851:Ednrb UTSW 14 103821674 missense probably benign 0.04
R2852:Ednrb UTSW 14 103821674 missense probably benign 0.04
R3708:Ednrb UTSW 14 103817080 missense probably damaging 1.00
R4887:Ednrb UTSW 14 103820011 missense possibly damaging 0.95
R5626:Ednrb UTSW 14 103843128 missense probably damaging 0.98
R5688:Ednrb UTSW 14 103823395 missense probably damaging 1.00
R5802:Ednrb UTSW 14 103821714 missense probably damaging 0.97
R5834:Ednrb UTSW 14 103820877 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
MMRRC Submission 037048-MU
Last Updated 2018-05-29 2:55 PM by Anne Murray
Record Created 2013-06-21 9:50 PM by Tiana Purrington
Record Posted 2014-03-28
Phenotypic Description

Figure 1. Phenotype of the gus-gus mouse. The homozygous gus-gus mice have a piebald appearance.

The hypopigmentation phenotype of gus-gus mice was initially identified among N-ethyl-N-nitrosourea (ENU)-induced G3 animals; the gus-gus homozygous mice have a piebald appearance (i.e., a variable black and white spotting pattern; Figure 1). Although they appear healthy at birth, the gus-gus mice die prematurely at or around weaning; cause of death has not been determined.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations, one of which affected Ednrb, a gene known to cause pied spotting when mutated (1). The Ednrb mutation is a G to A transition at base pair 103,820,013 (v38) on Chromosome 14, or base pair 24,161 in the GenBank genomic region NC_000080 encoding Ednrb. The mutation corresponds to residue 1,337 in the mRNA sequence NM_007904.4 within exon 6 of 7 total exons or residue 1,523 in the mRNA sequence NM_001136061.2 within exon 7 of 8 total exons.

 

24148  TTGGACTACATTGGTATCAACATGGCT

367    -L--D--Y--I--G--I--N--M--A-

 

Genomic sequence is shown; numbering corresponds to NC_000080. The mutated nucleotide is indicated in red.  The mutation results in a glycine (G) to aspartic acid (D) substitution at amino acid 371 in both endothelin receptor type B (ETBR) isoforms.

Protein Prediction
Figure 2. The topography and domain structure of ETBR. (A) ETBR is a G-protein coupled receptor with seven transmembrane (TM) domains. Shown are the locations of the signal peptide and ET-1-induced cleavages of the N-terminus. The post-translational modifications that occur on ETBR are also shown: N-linked glycosyaltion at N60, disulfide bond formation between C174 and C255, palmitoylation at C402, C403, and C405, the 13 phosphorylation (Ps) sites, and the location of Gcoupling. The location of the gus-gus mutation within the TM7 is marked by a red asterisk. (B) The domain structure of ETBR. The gus-gus mutation is a glycine to aspartic acid substitution at residue 371 within TM7. Abbreviations: TM, transmembrane domain; SP, signal peptide; CT, C-terminus, Ps, phosphorylation.

Ednrb encodes endothelin receptor type B (ETBR), a member of the endothelin (ET) receptor family of rhodopsin-like G protein-coupled receptors (GPCRs; see the record for Bemr3) (2-5).  The rhodopsin-like GPCRs have seven helical transmembrane domains, three extracellular and three intracellular loops, an extracellular N-terminus, and a cytoplasmic C-terminus (Figure 2).

 

The extracellular N-terminus of ETBR has several known functions (3).  Within the endoplasmic reticulum (ER) lumen, a signal peptide comprised of the N-terminal 26 amino acids is cleaved after facilitating the translocation of ETBR across the ER membrane (6;7).  At the cell surface, the N-terminus of the mature protein is further susceptible to ligand (ET-1)-induced cleavage between Arg65 and Ser66 by an unidentified extracellular soluble or membrane-bound metalloprotease (e.g., a member of a disintegrin and metalloprotease (ADAM) family (see the record for wavedx for information about Adam17) or matrix metalloprotease (MMP; see the record for cartoon for information about Mmp14)) (8-10).  A mutant ETBR lacking the first 64 amino acids retained the functional properties of full-length ETBR when expressed in vitro, however, there was a 15-fold reduction in cell-surface expression (8). These data indicate that N-terminal proteolysis of ETBR regulates ETBR cell surface expression (8). A region containing 29 amino acids of the N-terminus adjacent to the first transmembrane domain (amino acids 74-101 in mouse) functions to stabilize the interaction between the endothelin ligand(s) and ETBR (11). Takasuka et al.  propose that the 29 N-terminal amino acids may interact with another part of ETBR (e.g., the extracellular loops) to stabilize the receptor-ligand complex (11). For example, the binding of the ET ligand, ET-1, to ETBR is almost irreversible (11;12); when exposed to acid washes and 2% SDS, the receptor-ligand complex remains intact (13). The complex within living cells remains stable even when transported into late endosomal/lysosomal compartments (14).

 

The transmembrane domains (TM) and the intervening extracellular loops of ETBR regulate agonist selectivity and binding (15;16). The ligand binding domain of ETBR is Ile138-Ile197 within the second transmembrane domain (17).

 

The C-terminal tail of ETBR is essential for Gαq protein coupling and the regulation of the stimulation of the epithelial sodium/hydrogen exchanger 3 (NHE3), a protein necessary for renal and intestinal sodium reabsorption (18;19). The amino acid sequence 399Ser-Cys-Leu-Cys402 within the C-terminal tail is conserved between ETBR and ETAR, another member of the ET receptor family, and is proposed to be essential for signal transduction (18). The C-terminal tail of ETBR also directs the receptor’s intracellular trafficking route irrespective of ligand stimulation (20). ETBR is initially transported to the plasma membrane and then internalized to lysosomes where it undergoes proteolytic degradation (20). The C-terminal tail of ETBR mediates the interaction with β-arrestin and subsequent internalization of the receptor, lysosomal sorting, and its degradation (20;21).

 

ETBR undergoes several posttranslational modifications: (i) Asn60 is within an N-linked glycosylation consensus sequence (Asn-X-Ser/Thr), however, this site is released upon the proteolytic processing of ETBR; no other glycosylation occurs on ETBR (3;6;22). (ii) Thirteen potential phosphorylation sites (most at the end of the C-terminus; aa 435-442) have been identified (15;23). ETBR phosphorylation is proposed to regulate receptor function as well as receptor desensitization by GPCR kinase or β-arrestin-mediated phosphorylation (15;23). (iii) Three cysteines (Cys402, 403, and 405) within the C-terminal tail are potential palmitoylation sites (24). (iv) Cysteines 174 and 225 are proposed to cross-link extracellular loops one and two by a disulfide bond (25).

 

ETBR couples to the Gαi subunit of the heterotrimeric G-protein at the third intracellular loop (amino acids 297-324) (26;27). A consensus sequence including Lys210, Val214, Pro215, Lys216, and Val220 (210LysXXXValProLysXXXVal220) within the second intracellular loop of ETBR is required for ET-1-mediated stimulation of NHE3 (19)

 

ETBR may form homodimers as well as heterodimers or higher order oligomers with ETAR (15). Formation of the dimers or higher order oligomers is proposed to function in modifying ligand binding, receptor activation, densensitization and transmembrane signaling (15).

 

In humans, an alternative ETBR isoform (ETB-SVR) is generated by the use of an alternative splice site within exon 7 (base pair 2,970) in human EDNRB (18). ETB-SVR differs from the canonical ETBR sequence at the intracellular C-terminal domain and the 3’-untranslated region (18). In contrast to the canonical ETBR C-terminal tail (amino acids 398-442) that has five cysteines, nine serines, two tyrosines, and no threonine, the ETB-SVR C-terminal tail (amino acids 398-436) has one cysteine, two serines, two threonines, and no tyrosines (18). ETB-SVR is functionally distinct from ETBR; a possible function of ETB-SVR has not been identified (18). The extent of C-terminal tail phosphorylation by β-adrenergic receptor kinase-like may explain, in part, the functional difference between ETBR and ETB-SVR (18).  Another study identified a third, ETBR isoform (ETB1) in human brain, placenta, lung, and heart by reverse transcriptase polymerase chain reaction; ETB1 is not expressed in bovine, rat and porcine tissues (28). ETB1 encodes an ETBR protein that has an additional 10 amino acids in the second cytoplasmic domain due to alternative splicing of the intron between the second and third exon (28).

 

The gus-gus mutation is a glycine to aspartic acid substitution at amino acid 371 within TM7.

Expression/Localization

During embryonic development, Ednrb is expressed in the pre-migratory and migrating neural crest (NC) cells as well as less abundantly in the surrounding mesenchyme (29;30). Ednrb is expressed in human melanoma cell lines; melanoma metastases expressed higher levels of Ednrb when compared to Ednrb expression in primary tumor samples (31).

 

In mouse and rat, ETBR is expressed in most tissues (22;32) including vascular endothelial cells and vascular smooth muscle cells (VSMCs) (8;33), the cochlea (34), tubular epithelial cells, renal vessels, inner medullary collecting duct (CD), outer medullary CD, cortical CD, and other nephron segments of the kidney (35-38), melanocytes (31), choroid and retina (39;40) as well as the myenteric plexus, mucosal layer, ganglia, and blood vessels of the submucosa of the colon (41-43).

 

ETBR is localized to the plasma membrane in most cells. However, in subfractionated cardiac membranes, ETBR was localized predominantly to intracellular membranes (44). Confocal microscopy of ventricular myocytes determined that ETBR was localized to the nuclear membrane (44). The nuclear ETBR was able to bind ligands and stimulated an increase in nuclear cisternal calcium content (44). Within the mouse intestine, ETBR is localized to the nuclei of mucosal epithelial cells (45)

 

The ETB-SVR isoform mRNA is expressed in the lung, placenta, kidney, and skeletal muscle; ETB-SVR mRNA was not expressed in smooth muscle or endothelial cells (18).

Background

There are two ET receptor subtypes expressed in mammals: ETAR and ETBR (4;5;31). A third ET receptor subtype, ETCR, has been identified in Xenopus laevis; a mammalian homologue of ETCR has not been identified (36;46). There are three ET ligands that associate with the ET receptors:  ET-1, ET-2, and ET-3. Each of the ET receptors exhibit different affinities for the ET ligands: ETAR has high affinity for ET-1 and ET-2, but low affinity for ET-3; ETCR has higher affinity for ET-3 than for ET-1 and ET-2; while ETBR exhibits equal affinity for all of the ET ligands (4;5;46).

 

The ET receptors couple to heterotrimeric G-proteins (ETAR: Gq and Gs; ETBR: Gi and Gq) to activate several signaling components including phospholipase D (27;47;48), phospholipase C (PLC; (49;50)), phospholipase A2 (51), cytosolic calcium (52;53), Na+/H+ exchange (54), cGMP production (55), cAMP production (49), tyrosine kinases (56;57), and mitogen-activated protein kinases (MAPKs) (58;59). The ET-activated ET receptors mediate several physiological actions including, but not limited to, vasoconstriction (60), vasodilation (61), activation of DNA synthesis and mitogenesis (62;63), induction of Fos transcription (64), stimulation of phosphatidylinositol (PI) hydrolysis in cerebellar granule cell neurons (63;65), depolarization of spinal neurons (66), and stimulation of substance P release (67). Several ETBR-associated functions are discussed in more detail below.

 

ETBR-associated functions

Development of NC-derived cell lineages

ET-associated signaling (ET-1/ETAR and ET-3/ETBR) is essential for NC cell proliferation, migration, differentiation, and transformation (68-70). The embryonic NC gives rise to pluripotent cells that migrate to different locations within the embryo during development (71). The NC cells subsequently differentiate into several cell types including adrenomedullary cells, craniofacial skeletal tissue, glia and some neurons of the peripheral nervous system, enteric neurons and glia, and melanocytes of the skin, hair and inner ear [reviewed in (71)].

 

ET-3/ETBR-associated signaling is required between embryonic day (E)10-E12.5 in the mouse for the survival and migration of enteric ganglion neurons and melanocytes derived from trunk/vagal NC cells (1;69;70;72-74). Other studies indicate that ETBR signaling may also stimulate melanocyte proliferation in the epidermis (75). ET-3/ETBR-associated signaling maintains enteric NC-derived cells (ENCCs) in a proliferative state (76;77), inhibits their differentiation (77;78), and is required for the normal migration of ENCCs (73;76).

Figure 3. Four signaling pathways are essential to melanocyte development. The Wnt/β-catenin, MC1R, Kit, and ET-3/ETBR signaling pathways regulate the transcription of microphthalmia-associated transcription factor (Mitf) in NC-derived melanocyte precursors as well as regulate the phosphorylation of the melanocyte-specific MITF isoform (MITF-M). The Mitf promoter is regulated by the transcription factors PAX3, SOX10, Lef1/TCF, and CREB during melanocyte development. MITF-M regulates several target genes to mediate melanocyte survival (Bcl2 and Met), proliferation (e.g., Cdk2 and Tbx2), and differentiation [e.g., Tyr, Tyrp1, Slc45a2, Dct, Pmel, and Mc1r). In the Wnt signaling pathway, binding of the Wnt ligand to a Frizzled/LRP-5/6 receptor complex leads to the activation of the cytosolic protein, Dishevelled. Dishevelled inhibits the β-catenin degradation complex containing APC, Axin, and GSK3. Stabilized hypophosphorylated β-catenin subsequently interacts with TCF/Lef1 in the nucleus to activate transcription. In MC1R signaling, αMSH activates MC1R, leading to GDP/GTP exchange on the G-protein. The GTP-bound Gα subunit is released and activates adenylyl cyclase. Adenylyl cyclase catalyzes the production of cAMP, the activation of PKA and PKA-induced activation of the CREB family of transcription factors. The SCF/c-Kit signaling pathway modifies MITF post-translationally by phosphorylating Ser73 by the mitogen-activated protein kinase (Ras/Raf/MEK/ERK) pathway and Ser409 through RSK. RSK activation also results in CREB phosphorylation/activation. The ET-3/ETBR signaling pathway induces the phosphorylation of Ser298 on MITF through activation of the phospholipase C/PIP2/DAG/PKC pathway; the ET-3/ETBR merges with the ERK signaling pathway downstream of c-Kit. For a more comprehensive view of ETBR signaling please see Figure 4.  See the text for more details about these signaling pathways. Abbreviations: PKC, protein kinase C; GSK, glycogen synthase kinase; APC, adenomatosis polyposis coli; cAMP, cyclic AMP; MITF, microphthalmia-associated transcription factor; MC1R, melanocortin 1 receptor; αMSH, alpha melanocyte stimulating hormone; LRP, low-density lipoprotein receptor-related protein; MEK, mitogen-activated protein kinase kinase 1/2; H-Ras, v-Ha-ras Harvey rat sarcoma viral oncogene homolog; c-Raf1, v-raf-1 murine leukemia viral oncogene homolog 1; RSK, ribosomal protein S6 kinase 90kDa; CREB, cAMP responsive element binding protein 1; PKA, protein kinase A; SCF, stem cell factor. Some protein structures are modeled after existing crystal structures: β-catenin, PDB:1I7W; MITF, PDB: 4ATH; PKC, PDB:1CPK.

Figure 4. Overview of ETBR-associated signaling. ET-1/ET-3-mediated activation of ETBR can stimulate the dissociation of Gβγ from Gαq. Gαq activates PLCβ, leading to the hydrolysis of PtdIns(4,5)P2 and the production of DAG and IP3. IP3 leads to the cytosolic mobilization of Ca2+ from the endoplasmic reticulum. The cytosolic Ca2+ and DAG activate RAP-1A that, in turn, activates B-Raf. DAG also activates the PKCε/C-Raf pathway.  B-Raf and C-Raf phosphorylate and activate MEK1/2, which phosphorylates ERK1/2. The ERK1/2 induces the activation of RSK, leading to the activation of CREB and ATF-1. CREB and ATF-1 induce cFos expression. Proliferation, cell migration, contraction, and vasoconstriction of vascular smooth muscle cells occur upon ERK1/2 stimulation. ET-1/ET-3-activated ETBR can also stimulate the dissociation of Gβγ from Gαi. The dissociated Gβγ subsequently activates PI3K, which produces PtdIns(3,4,5)P3 from PtdIns(4,5)P2 (PIP2). PIP2 recruits AKT, which phosphorylates eNOS, enhancing nitric oxide (NO) production. Enhanced NO production results in vascular relaxation of vascular endothelial cells. The activated Gαi subunit activates c-Src, which subsequently activates the SHC/Grb2/SOS/H-Ras/C-Raf pathway leading to contractility of vascular smooth muscle cells and proliferation. See text for more details. Abbreviations: ET-3, endothelin-3; ETBR, endothelin receptor type B; PI3K, phosphoinositide-3-kinase; AKT, v-akt murine thymoma viral oncogene homolog 1; eNOS, endothelial nitric oxide synthase; NO, nitric oxide; DAG, diacylglycerol; IP3, inositol trisphosphate; B-Raf, v-raf murine sarcoma viral oncogene homolog B1; PKCε, protein kinase C epsilon; MEK, mitogen-activated protein kinase kinase 1/2; H-Ras, v-Ha-ras Harvey rat sarcoma viral oncogene homolog; C-Raf, v-raf-1 murine leukemia viral oncogene homolog 1; RSK, ribosomal protein S6 kinase 90kDa; CREB, cAMP responsive element binding protein 1; ATF-1, activating transcription factor 1; cFos, cellular oncogene v-fos FBJ murine osteosarcoma viral oncogene homolog; ERK1/2, mitogen-activated protein kinases 3/1. Some protein structures are modeled after existing crystal structures: PLCβ, PDB:3OHM; RAP-1A, PDB:1C1Y; B-Raf, PDB:1UWH; PKCε, PDB:1GMI; c-Src, PDB:1A07; C-Raf, PDB:1C1Y; SHC, PDB:1MIL; AKT, PDB:1H10; eNOS, PDB:1M9J.

 

Four signaling pathways function during melanocyte development: Wnt/β-catenin, MC1R, Kit, and ET-3/ETBR (Figure 3). The Wnt/β-catenin pathway regulates the transcription of microphthalmia transcription factor (Mitf) in NC-derived melanocyte precursors by activating the TCF/Lef1 transcription factor; the transcription factors SOX10 (see the record for Dalmatian) and PAX3 also regulate the expression of melanocyte-specific Mitf [reviewed in (79)]. SOX10 is required for the survival and the maintenance of pluripotency of migrating NC progenitors (80) and also functions in melanocyte differentiation by regulating Tyrp2/Dct (81;82). MITF regulates several target genes to mediate melanocyte survival (Bcl2 and Met; (83;84)), proliferation (e.g., Cdk2 and Tbx2; (85;86)), and differentiation [e.g., Tyr (see the record for ghost), Tyrp1 (see the record for chi), Slc45a2 (see the record for cardigan), Dct, Pmel, and Mc1r (see the record for deer); reviewed in (87)]. Melanocyte stimulating hormone (MSH)-mediated activation of the melanocortin 1 receptor (MC1R) elevates cyclic-AMP levels to subsequently activate MAP kinase pathways and increase Mitf and Sox10 promoter activities as well as activates the CREB family of transcription factors (88;89).  ET-3 (or ET-1)/ETBR signaling activates a phosphatidylinositol-calcium second messenger system following binding and activation of G proteins (Figure 4). The GTP-bound Gα-q subunit activates phospholipase Cβ (PLCβ), leading to the hydrolysis of Ptdins(4,5)P2 and the production of diacylglycerol (DAG) and inositol trisphosphate (IP3) (90). IP3 leads to the mobilization of Ca2+ in the cytosol, while the DAG and cytosolic Ca2+ activate RAS-related protein-1a (RAP-1A), a member of the RAS oncogene family. Activated RAP-1A activates v-raf murine sarcoma viral oncogene homolog B1 (B-Raf). DAG also activates the PKCε/H-Ras/and C-Raf1 pathway (91). B-Raf and/or C-Raf1 phosphorylate and activate MEK1 and MEK2, which subsequently phosphorylate ERK1/2 (91).  ERK1/2 induces the activation of the p90 ribosomal S6 kinase (p90Rsk). The activation of the p90Rsk proteins leads to the phosphorylation of cAMP responsive element binding protein 1 (CREB1) and activating transcription factor 1 (ATF-1) (92;93). The transcriptional activity of ATF-1 and CREB1 induces cFos expression and subsequent cellular proliferation and migration as well as the induction of the Mitf promoter during melanocyte development. The Kit (see the record for Pretty2) and ET-3/ETBR signaling pathways merge at the level of Ras activation and subsequently induce the phosphorylation of MITF in mature melanocytes. ET-3/ETBR directly or indirectly maintains Sox10 expression and/or modulates SOX10 activity (71). Stanchina et al. propose that SOX10 and the ET-3/ETBR signaling pathway cooperate for the development of the enteric nervous system and melanocytic NC cell lineage (71). See the “Vasodilation” section for additional information about ETBR signaling.

 

Using a NC cell-specific Ednrb knockout (NCC ETB KO) mouse model, Zaitoun et al. determined that ganglia are absent from the distal third of the NCC ETB KO colon, and are decreased in number and size in the proximal and distal mid-colon (74). In the ganglionated region of the NCC ETB KO colons, there was an increase in vasoactive intestinal polypeptide (VIP) and nitric oxide synthase (nNOS) with a concomitant decrease in choline acetyltransferase (ChAT) in comparison to the wild-type mouse; these molecules in the enteric ganglia regulate motility of the gut (74). The expression of nNOS, VIP, and ChAT were inversely related to neuronal density (74).

 

In ENCCs, the RET receptor tyrosine kinase is activated by the glial cell-line-derived neurotrophic factor (GDNF) and GDNF family receptor α1 (GFRα1) complex [reviewed in (94)]. RET-associated signaling promotes the survival, proliferation, migration, and differentiation of enteric neurons through the activation of Akt, ERK and MAPK P38 [(95-97); reviewed in (94)]. In vitro and in vivo studies have demonstrated crosstalk between the RET and ET-3/ETBR signaling pathways during enteric nervous system development, however the molecular bases of this crosstalk is unknown (76;98;99).

 

Vasoconstriction

ET-1-mediated activation of ETAR and/or ETBR on vascular smooth muscle cells (VSMCs) induces vasoconstriction and VSMC proliferation (100). During vasoconstriction, ET-1/ETBR and/or ET-1/ETAR stimulate the phosphorylation of ERK1/2 (Figure 4(101)). ERK1/2 is a known regulator of cellular proliferation, differentiation, migration, and vasoconstriction (34;101).

 

ET-1/ETBR-associated signaling also promotes stretch-induced apoptosis in cultured VSMCs, and may thereby possibly play a role during hypertension-induced remodeling in conduit arteries (102). In an Ednrb knockout (Ednrb-/-) mouse with complete ligation of the right common carotid artery, vascular remodeling was accelerated while the levels of nitric oxide (NO; a component of the dilator response) release were decreased compared to wild-type mice (103).  Murakoshi et al. propose that the loss of ETBR-mediated apoptosis of VSMCs leads to neointimal hyperplasia (i.e., thickening of the blood vessel) and vascular stenosis (i.e., abnormal narrowing of the blood vessels) in the proximal carotid artery of the Ednrb-/- mouse after ligation (103).  They also suggest that a decrease in endothelium-derived relaxation factors and NO may enhance vascular remodeling in the KO mice after ligation (103).

 

The ET-1 ligand is elevated in patients with hypertension and is considered a key mediator of hypertension (60). ETBR mediates the clearance of circulating ET-1 by tightly binding the ligand and transporting it into lysosomal compartments (104-106). The endocytosed ET-1 subsequently negatively regulates ET-1 gene transcription (107). The decrease in circulating ET-1 also reduces the amount of ET-1 that can interact with ETAR, subsequently leading to a decrease in ETAR-mediated vascular contraction (106;108).

 

Vasodilation

ETBR-associated signaling can also induce vasodilation (33). Vascular endothelial cells (ECs) exclusively express ETBR, which mediates vasodilation upon ET-1 or ET-3-associated ETBR activation (109;110). Mechanistically, ET-1 or ET-3-induced ETBR activation promotes Gβγ dissociation from the Gαi subunit of the heterotrimeric G-protein (Figure 4). The dissociated Gβγ subsequently activates phosphatidylinositol 3 kinase (PI3K) to produce PtdIns(3,4,5)P3 (PI(3,4,5)P3). PI(3,4,5)P3 recruits and activates AKT, which subsequently phosphorylates eNOS, leading to increased NO production, the release of prostacyclin (a vasodilator and inhibitor of platelet aggregation), and vasodilation (103;111-113). In an EC-specific Ednrb knockout mouse (EC ETB KO), ETBR-mediated vasodilation was impaired and the plasma concentration of ET-1 was increased; other ETBR-mediated functions in non-ECs (i.e., enteric nervous system development and pigmentation) were not affected (114).

 

Regulation of natriuresis and diuresis

ETBR-associated signaling in the medullary CD, outer medullary CD, and cortical CD regulates systemic blood pressure (36). ET-1/ETBR-associated signaling reduces vasopressin-stimulated cAMP accumulation (115-117) and osmotic water permeability (118;119) in the CD. CD-specific knockout of Ednrb (CD ETB KO) resulted in hypertension on a normal-sodium diet, which was further exacerbated on a chronic high-sodium diet; the mice had no other gross morphological abnormalities (36). Upon acute sodium loading, the CD ETB KO mice exhibited impaired sodium excretion (36). CD-derived ET-1 functions through the activation of ETBR to promote natriuresis (excretion of sodium in the urine) and diuresis (urine production by the kidney) to subsequently lower blood pressure (120-123).  Interestingly, CD-specific ET-1 knockout mice displayed more severe hypertension than CD ETB KO mice, suggesting that ET-1 may also signal in a paracrine manner to ETBR and ETAR outside the CD to regulate natriuresis and diuresis (36).

 

Inflammatory pain and cutaneous inflammation

Inflammatory pain, tissue swelling, and neutrophil infiltration are mediated by ET-1/ETBR-associated signaling (124). An Ednrb knockout mouse was treated with pharmacological agents phenylbenzoquinone (induces algesia, a sensitivity to inflammatory pain) and arachidonic acid (induces pruritus and cutaneous inflammation) (124).  The Ednrb null mice did not display sensitivity to inflammatory pain when compared to wild-type mice; noninflammatory pain was equivalent between the null and wild type mice (124). In addition, null and heterozygous mice exhibited reduced arachidonic acid-induced cutaneous inflammatory responses and neutrophil infiltration compared to wild-type mice (124).

 

Human diseases associated with ETBR defects

Mutations in EDNRB are linked to several diseases including ABCD syndrome [OMIM: #600501; (125)], Waardenburg syndrome type 4A [WS4A; OMIM: #277580; (126)], and susceptibility to Hirschsprung disease 2 [HSCR2; OMIM: #600155; (10;126;127)]. Patients with ABCD syndrome exhibit albinism, retinal depigmentation, bilateral deafness, and aganglionosis of the large intestine together with total absence of neurocytes and nerve fibers in the small intestine (125). Patients with WS4A also exhibit pigment abnormalities of the hair, skin, and eyes due to a lack of melanocytes, and congenital sensorineural hearing loss due to a lack of melanocytes in the cochlea, as well as Hirschsprung disease, a congenital absence of ganglion cells distal portion of the gastrointestinal tract (10;126-128).  

 

A link between ETBR-associated signaling and melanoma has been described [reviewed in (92)]. Increased EDNRB expression has been detected in melanoma metastases (compared to primary tumors) (129). EDNRB mutations that impair ETBR function have been detected in melanoma patients (130)

Putative Mechanism

Mice homozygous for targeted as well as naturally occurring Ednrb null mutations (e.g., MGI:1856148, MGI:1856149, MGI:1857161, and MGI:3795226) exhibit a piebald appearance due to the absence of NC-derived melanocytes in the epidermis (1;73;114;128;131-133). Ednrb null mice also exhibit an absence of choroidal melanocytes; neuroectoderm-derived pigment epithelium melanocytes develop normally (1). Ednrb null mice display early postnatal lethality [from ~postnatal day 15 to up to seven weeks after birth; (1;114;128;133)], distended and aganglionic colon [i.e., megacolon; (1;73;128;133;134)], reduced inflammatory response to topical application of arachidonic acid (124), and deafness due to a loss of strial intermediate cells and degeneration of the organ of Corti (128). A naturally occurring deletion in ETBR occurs in the spotting lethal (sl) rat model (135). Similar to the mouse models described above, homozygous sl rats exhibit abnormal epidermal melanocyte and enteric nervous system development as well as premature postnatal death following intestinal aganglionosis and obstruction (135). Homozygous sl rats that express a dopamine-β-hydroxylase-ETBR transgene (ETBR is expressed in the adrenal glands and other adrenergic neurons) survive to adulthood and exhibit normal enteric development (121;136). The sl rats that express the ETBR transgene are deficient in ETBR expression in the kidney, vascular endothelium, and vascular smooth muscle; they did not exhibit vasoconstriction, vasodilation, or diuretic action (135).

 

Similar to spontaneous and targeted Ednrb knockout mouse models, the gus-gus mice exhibit a piebald appearance and early postnatal lethality. The Ednrb knockout mouse models have established that the observed pigmentation defects are due to the absence of NC-derived melanocytes in the hair bulbs of non-pigmented areas (1;73;114;128;131-133). Other phenotypes associated with Ednrb deficiency have not been examined in the gus-gus mouse.

Primers PCR Primer
gus-gus(F):5'- CCCATCACATATATCGCAAGGCAGG -3'
gus-gus(R):5'- CCTCCCTCGCTTCCAAATGAGAATC -3'

Sequencing Primer
gus-gus_seq(F):5'- GGGAAAATTAGCAATCTTCCAGCTC -3'
gus-gus_seq(R):5'- gacagacggagaaagagacag -3'
Genotyping

Gus-gus genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Gus-gus(F): 5’- CCCATCACATATATCGCAAGGCAGG -3’

Gus-gus(R): 5’- CCTCCCTCGCTTCCAAATGAGAATC -3’

 

Sequencing Primer

Gus-gus_seq(F): 5’- GGGAAAATTAGCAATCTTCCAGCTC -3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 517 nucleotides is amplified (Chr.14: 103819795-103820311, GRCm38):

 

   1 cccatcacat atatcgcaag gcagggaaaa ttagcaatct tccagctctc tctagatagc

 61 aatattggtg tgttttttaa agcctatatt tgatgccaga tcacaggaaa cattttattt

121 tagaagagtt tcttacctta aagcagtttt tgaatctttt gctcaccaaa tacagagcga

181 ttggattgat gcaggagttc aaagaagcca tgttgatacc aatgtagtcc aaaaccaaca

241 aaaagctgaa agaaacccaa agttgtcttt aaagattaca tccctccaag tgtgtattta

301 acttgcacct ttatgttttt atgaagaaag cccaaatcac ctacatgcaa taattttatt

361 tagccactga tttaccagca gaggtgcctg tctgtgtctc tgcctgcctg tctctttctc

421 cgtctgtctt tggcatctcc actgccctat cccaccttca ccaccaatat gcagcatttc

481 ttttaaaaat aagattctca tttggaagcg agggagg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (C>T, Chr. + strand; G>A, sense strand).

References
  132. Gruneberg, H. (1952) The Genetics of the Mouse. Martinus Nijhoff, The Hague.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsTiana Purrington and Bruce Beutler
List [record 1 of 1]