Phenotypic Mutation 'craw' (pdf version)
Allelecraw
Mutation Type nonsense
Chromosome6
Coordinate124,867,746 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Cd4
Gene Name CD4 antigen
Synonym(s) L3T4, Ly-4
Chromosomal Location 124,864,692-124,888,221 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013488; MGI:88335

MappedYes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000024044]
AlphaFold P06332
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274
AA Change: Q359*

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(27) : Targeted(15) Gene trapped(6) Spontaneous(2) Chemically induced(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
seshat APN 6 124872977 missense possibly damaging 0.81
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
Doubles UTSW 6 124872458 missense probably benign 0.01
fourless UTSW 6 124870244 critical splice donor site probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
R7943:Cd4 UTSW 6 124870244 critical splice donor site probably null
R9187:Cd4 UTSW 6 124867688 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 037524-MU
Last Updated 2019-11-12 10:57 AM by Bruce Beutler
Record Created 2013-06-27 11:47 PM by Kuan-Wen Wang
Record Posted 2014-09-12
Phenotypic Description
Figure 1. Craw mice lack a T-dependent IgG response to OVA-Alum. ​Abbreviations: B6, C57BL/6J.
Figure 2. Craw mice lack a T-dependent IgG response to rSFV-β-gal. Abbreviations: B6, C57BL/6J.
Figure 3. Flow cytometric analysis of peripheral blood from craw mice (top) determined that the craw mice do not have detectable CD4+ T cells (middle), but exhibit a strong increase in the frequency of CD8+ T cells (bottom). Abbreviations: B6, C57BL/6J.

The craw phenotype was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for T-dependent (TD) humoral responses. Craw mice lack T-dependent IgG responses to both ovalbumin administered with aluminum hydroxide (OVA-Alum; Figure 1) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 2); craw mice exhibit normal T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (not shown). Flow cytometric analysis of peripheral blood from craw mice determined that the craw mice do not have detectable amounts CD4+ T cells, but exhibit a strong increase in the frequency of CD8+ T cells (Figure 3).
Nature of Mutation

The Cd4 gene was directly sequenced as a candidate gene due to the lack of CD4+ T cells in the craw mice. The craw mutation is a C to T transition at base pair 124,867,746 (v38) on chromosome 6, or base pair 20,465 in the GenBank genomic region NC_000072 encoding Cd4. The mutation corresponds to residue 1,245 in the NM_013488 mRNA sequence in exon 7 of 10 total exons.

1229 GAGCAGAAAGTAGTTCAAGTGGTGGCCCCTGAG 

354  -E--Q--K--V--V--Q--V--V--A--P--E-

The mutated nucleotide is indicated in red.  The mutation results in substitution of a premature stop codon (*) for glutamine (Q) at amino acid 359 in the CD4 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain structure of CD4. The Cd4 gene encodes a 457 amino acid single-pass type I transmembrane protein that belongs to the immunoglobulin superfamily of molecules. The protein contains a large extracellular region consisting of four immunoglobulin (Ig)-like domains (D1-D4). The most N-terminal of these domains (yellow) shares considerable homology with immunoglobulin κ light-chain variable regions, while the other three domains more closely resemble the constant domains of immunoglobulin molecules. The craw mutation mutation results in substitution of a premature stop codon (*) for glutamine (Q) at amino acid 359. Click on the image to view other mutations found in CD4. Click on each mututation for more specific information.

Cd4 encodes CD4, a member of the immunoglobin superfamily that is a co-receptor for the T cell receptor (TCR). Together with the TCR, CD4 engages major histocompatibility complex (MHC) class II molecules in antigen presenting cells (1-4). Additional data suggests that CD4 may function to initiate, or augment, the early stages of T cell activation rather than stabilizing TCR-MHC interaction (5). The craw mutation is a nonsense mutation within the extracellular immunoglobulin (Ig)-like C2-type 3 domain (i.e., D4; Figure 4).

Please see the record thoth for information about Cd4.

Putative Mechanism

Signaling via the CD4-TCR complex is essential at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis. Coding of the premature stop codon in craw results in loss of peripheral CD4+ T cells as well as the loss of T-dependent humoral responses, indicating that any protein product expressed in craw is non-functional in generating a TCR-mediated signaling response.

Primers PCR Primer
craw_pcr_F: AGCTCTTAGCCAGGAAGACCTCAC
craw_pcr_R: TCCACGCTTACAGCTTGAACCC

Sequencing Primer
craw_seq_F: CTCACTCCTAAGCTGTGTGGAAG
craw_seq_R: TTGAACCCCGAGCAGCAG
Genotyping

Craw genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Craw(F): 5’- AGCTCTTAGCCAGGAAGACCTCAC-3’

Craw(R): 5’- TCCACGCTTACAGCTTGAACCC-3’

Sequencing Primer

Craw_seq(F): 5’- CTCACTCCTAAGCTGTGTGGAAG-3’
 

Craw_seq(R): 5’- TTGAACCCCGAGCAGCAG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 509 nucleotides is amplified (Chr.6: 124867421-124867929, GRCm38; NC_000072):

 1 agctcttagc caggaagacc tcactcctaa gctgtgtgga agtgggaagt aactggagga       

61 tacaagtggg aacctagagc ccaggacccc tctctctcct cacttctatc tccaacctct      

121 gtacaaaatg cctccgtgag gagctaggga actgagactc taggtcggca tagcttgtcc      

181 ctggggcttt ccacaggtga agagtccgag gcttagggtg aggccttaga aactggatcc      

241 ttaccctgga tcctggagtc catcttgacc ttatcacctt cactcagtag acactgccac      

301 agccctgtct caggggccac cacttgaact actttctgct cctcagagac cctggcctcc       

361 tggttctcct gcttcagggt cagtctcatc ttgggagagg taggtcccat cacctcacag      

421 gtcaaagtat tgttgagctg agccactgca gaggaaggag aggcagagag ctggatcctg      

481 ctgctcgggg ttcaagctgt aagcgtgga

FASTA sequence

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (C>T, Chr. (+) strand; G>A, sense strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler