Incidental Mutations

129 incidental mutations are currently displayed, and affect 105 genes.
3 are Possibly Damaging.
9 are Probably Damaging.
103 are Probably Benign.
13 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 129] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511438 UTSW 2010300C02Rik 0.101 FR4449 222 N 1 37625035 E594V T A missense Homo probably benign 0.399 04/05/2018
2 511439 UTSW 2010300C02Rik 0.101 FR4449 222 N 1 37625036 E594* C A nonsense Homo probably null 04/05/2018
3 511505 UTSW 4932415D10Rik 0.148 FR4449 190.46 N 10 82285469 TTCAGT TT frame shift Homo probably null 04/05/2018
4 511466 UTSW Akap9 0.349 FR4449 215.1 N 5 3981214 GGTATTGCATTTCTTATCT G unclassified Homo probably benign phenotype 04/05/2018
5 511489 UTSW Amfr 0.476 FR4449 222 N 8 94005159 G30R C G missense Homo probably damaging 1.000 phenotype 04/05/2018
6 511529 UTSW Anxa7 0.095 FR4449 222 N 14 20469411 G113E C T missense Homo probably damaging 0.967 0.040 phenotype 04/05/2018
7 511554 UTSW Apc 0.987 FR4449 217.47 N 18 34282000 AATAAAGC AATAAAGCCGATAAAGC intron Het probably benign phenotype 04/05/2018
8 511555 UTSW Apc 0.987 FR4449 217.47 N 18 34282005 AGC AGCCAATAACGC intron Het probably benign phenotype 04/05/2018
9 511534 UTSW Apol6 0.028 FR4449 214.46 N 15 77051443 TTT TTTGATT nonsense Homo probably null phenotype 04/05/2018
10 511538 UTSW Arid1b 0.528 FR4449 102.47 N 17 4995589 CGG CGGTGG small insertion Het probably benign phenotype 04/05/2018
11 511528 UTSW B430218F22Rik 0.073 FR4449 215.1 N 13 118386851 CGGCG CGGCGATGGCG small insertion Homo probably benign 04/05/2018
12 511483 UTSW Blm 1.000 FR4449 176.47 N 7 80512908 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 04/05/2018
13 511546 UTSW Brd2 1.000 FR4449 217.47 N 17 34116336 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA unclassified Het probably benign phenotype 04/05/2018
14 511511 UTSW Btnl10 0.140 FR4449 214.46 N 11 58923928 AAG AAGGAG small insertion Homo probably benign 04/05/2018
15 511486 UTSW Cacna1a 0.756 FR4449 217.47 N 8 84638714 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
16 511487 UTSW Cacna1a 0.756 FR4449 217.47 N 8 84638720 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
17 511488 UTSW Cacna1a 0.756 FR4449 217.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
18 511562 UTSW Calhm1 0.403 FR4449 217.47 N 19 47141274 TGGC TGGCTGTGGCTGCGGC unclassified Het probably benign phenotype 04/05/2018
19 511495 UTSW Ccdc15 0.221 FR4449 123.47 N 9 37315158 C CTTTAT frame shift Het probably null 04/05/2018
20 511526 UTSW Ccdc85c 0.354 FR4449 141.54 N 12 108274616 CCG CCGACG small insertion Het probably benign phenotype 04/05/2018
21 511525 UTSW Ccnk 1.000 FR4449 217.47 N 12 108202507 TTCCCAC T unclassified Het probably benign phenotype 04/05/2018
22 511527 UTSW Cdhr2 0.070 FR4449 214.49 N 13 54725924 AGTC AGTCGTC small insertion Homo probably benign phenotype 04/05/2018
23 511440 UTSW Cdk15 0.202 FR4449 218 N 1 59257823 A ATCTAAAAGG small insertion Homo probably benign 04/05/2018
24 511557 UTSW Cdx1 0.608 FR4449 217.47 N 18 61019881 GCTG GCTGCTCCTG small insertion Het probably benign phenotype 04/05/2018
25 511485 UTSW Cfap46 0.064 FR4449 118.03 N 7 139638795 T C utr 3 prime Homo probably benign 04/05/2018
26 511468 UTSW Cgref1 0.068 FR4449 107.47 N 5 30933776 TTC TTCGTC unclassified Het probably benign 04/05/2018
27 511469 UTSW Cgref1 0.068 FR4449 162.46 N 5 30933778 CTT CTTATT nonsense Homo probably null 04/05/2018
28 511512 UTSW Cluh 0.565 FR4449 192.47 N 11 74669532 G GACTGAA small insertion Het probably benign phenotype 04/05/2018
29 511516 UTSW Cntnap1 0.519 FR4449 217.47 N 11 101189569 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
30 511517 UTSW Cntnap1 0.519 FR4449 217.47 N 11 101189593 AGCC AGCCCCCGCC unclassified Het probably benign phenotype 04/05/2018
31 511449 UTSW Cpne1 0.614 FR4449 126.63 N 2 156073502 CCTACT CCT intron Homo probably benign phenotype 04/05/2018
32 511474 UTSW Cttnbp2 0.264 FR4449 217.47 N 6 18367462 CTGCTG CTGCTGTTGCTG utr 3 prime Het probably benign phenotype 04/05/2018
33 511547 UTSW Cul9 0.417 FR4449 167.47 N 17 46500856 TCC TCCGCC small insertion Het probably benign phenotype 04/05/2018
34 511500 UTSW Dbr1 0.909 FR4449 217.47 N 9 99583674 AGGAGG AGGAGGGGGAGG unclassified Het probably benign phenotype 04/05/2018
35 511501 UTSW Dbr1 0.909 FR4449 217.47 N 9 99583686 AGGAGG AGGAGGCGGAGG unclassified Het probably benign phenotype 04/05/2018
36 511502 UTSW Dbr1 0.909 FR4449 217.47 N 9 99583696 GGAGGA GGAGGAAGAGGA unclassified Het probably benign phenotype 04/05/2018
37 511518 UTSW Dhx8 0.973 FR4449 214.46 N 11 101738184 AGACCG AGACCGTGACCG small insertion Homo probably benign phenotype 04/05/2018
38 511519 UTSW Dhx8 0.973 FR4449 149.47 N 11 101738190 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC small deletion Het probably benign phenotype 04/05/2018
39 511520 UTSW Dhx8 0.973 FR4449 214.46 N 11 101738194 CG CGAGACAG small insertion Homo probably benign phenotype 04/05/2018
40 511521 UTSW Dhx8 0.973 FR4449 217.47 N 11 101738206 CG CGAGACAG small insertion Het probably benign phenotype 04/05/2018
41 511522 UTSW Dhx8 0.973 FR4449 217.47 N 11 101738207 G GAGACCC small insertion Het probably benign phenotype 04/05/2018
42 511470 UTSW Dspp 0.000 FR4449 217.47 N 5 104178388 CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG small deletion Het probably benign phenotype 04/05/2018
43 511444 UTSW Dusp10 0.366 FR4449 222 N 1 184037056 C73F G T missense Homo probably damaging 0.996 0.268 phenotype 04/05/2018
44 511462 UTSW Erich3 0.217 FR4449 214.46 N 3 154763513 GA GAGAA unclassified Homo probably benign 04/05/2018
45 511445 UTSW Ermn 0.124 FR4449 217.47 N 2 58048074 CTT CTTGTT unclassified Het probably benign 04/05/2018
46 511506 UTSW Fgd6 0.420 FR4449 131.46 N 10 94044320 GGAT G small deletion Homo probably benign 04/05/2018
47 511441 UTSW G530012D18Rik 0.203 FR4449 173.43 N 1 85577180 GAGAGAGAGAGAGAGAGACAGAGA GAGAGA small deletion Homo probably benign 04/05/2018
48 511461 UTSW Gar1 FR4449 214.46 N 3 129830704 GCCGCCTCCGCC GCCGCC small deletion Homo probably benign 04/05/2018
49 511459 UTSW Gatad2b 0.551 FR4449 130.47 N 3 90341917 AGAC A small deletion Het probably benign phenotype 04/05/2018
50 511442 UTSW Gigyf2 0.751 FR4449 225.01 N 1 87428585 C T unclassified Het probably benign phenotype 04/05/2018
51 511548 UTSW Gm16519 0.278 FR4449 214.46 N 17 70929338 A AGAT small insertion Homo probably benign 04/05/2018
52 511507 UTSW Gm4340 FR4449 185.47 N 10 104196082 AGC AGCGGC small insertion Het probably benign 04/05/2018
53 511508 UTSW Gm4340 FR4449 217.47 N 10 104196085 AGC AGCGGC small insertion Het probably benign 04/05/2018
54 511509 UTSW Gm4340 FR4449 212.47 N 10 104196086 GCA GCATCA small insertion Het probably benign 04/05/2018
55 511549 UTSW Gpatch11 0.214 FR4449 217.47 N 17 78842168 AGGAAG AGGAAGCGGAAG small insertion Het probably benign 04/05/2018
56 511550 UTSW Gpatch11 0.214 FR4449 217.47 N 17 78842176 GAAGAG GAAGAGCAAGAG small insertion Het probably benign 04/05/2018
57 511551 UTSW Gpatch11 0.214 FR4449 186.47 N 17 78842181 GG GGCAGACG small insertion Het probably benign 04/05/2018
58 511475 UTSW Hoxa10 0.000 FR4449 87.26 N 6 52234186 Q250L T A missense Homo possibly damaging 0.595 phenotype 04/05/2018
59 511476 UTSW Igkv12-89 FR4449 214.46 N 6 68835280 GCA GCAGCAGCAACA small insertion Homo probably benign 04/05/2018
60 511457 UTSW Igsf10 0.271 FR4449 222 N 3 59319110 R2381C G A missense Homo probably damaging 1.000 04/05/2018
61 511530 UTSW Il17rd 0.000 FR4449 217.47 N 14 27082678 GGC GGCAGC utr 5 prime Het probably benign phenotype 04/05/2018
62 511558 UTSW Ints5 0.379 FR4449 109.01 N 19 8897230 R851Q G A missense Het probably benign 0.099 phenotype 04/05/2018
63 511458 UTSW Isg20l2 0.912 FR4449 217.47 N 3 87931713 AGA AGAGGA unclassified Het probably benign phenotype 04/05/2018
64 511491 UTSW Kcng4 0.020 FR4449 222 N 8 119633519 Y39* G T nonsense Homo probably null 0.660 phenotype 04/05/2018
65 511544 UTSW Kifc5b 0.569 FR4449 94.01 N 17 26924217 E321A A C missense Het probably benign 0.000 04/05/2018
66 511479 UTSW Klra2 0.020 FR4449 214.97 N 6 131221846 TCCACAG TCCACAGAAACCCACAG frame shift Homo probably null phenotype 04/05/2018
67 511480 UTSW Kmt2b 1.000 FR4449 217.47 N 7 30586361 CCTCCT CCTCCTGCTCCT unclassified Het probably benign phenotype 04/05/2018
68 511481 UTSW Kmt2b 1.000 FR4449 217.47 N 7 30586366 TCCTCC TCCTCCACCTCC unclassified Het probably benign phenotype 04/05/2018
69 511482 UTSW Kmt2b 1.000 FR4449 217.47 N 7 30586369 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
70 511515 UTSW Krt10 0.337 FR4449 214.47 N 11 99389267 ACC ACCACCTCC unclassified Het probably benign phenotype 04/05/2018
71 511564 UTSW Las1l FR4449 217.47 N X 95940832 GA GAGAA small insertion Het probably benign 04/05/2018
72 511460 UTSW Lce1m FR4449 218.92 N 3 93018152 AC ACTGCTGCTGCCGC unclassified Het probably benign 04/05/2018
73 511499 UTSW Leo1 0.974 FR4449 217.47 N 9 75450573 GTACCATGCA G critical splice donor site Het probably benign phenotype 04/05/2018
74 511454 UTSW Lkaaear1 0.013 FR4449 217.47 N 2 181697571 CA CATCTCCAGCTCTA unclassified Het probably benign 04/05/2018
75 511493 UTSW Maml2 0.188 FR4449 214.46 N 9 13621456 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA small deletion Homo probably benign 04/05/2018
76 511456 UTSW Med12l 0.503 FR4449 168.47 N 3 59275963 CAG CAGTAG nonsense Het probably null phenotype 04/05/2018
77 511443 UTSW Mgat4e 0.179 FR4449 119.59 N 1 134540997 GTCGTAGTCATCGT GTCGT utr 3 prime Homo probably benign 04/05/2018
78 511471 UTSW Mn1 0.000 FR4449 189.47 N 5 111419710 GCA GCAACA small insertion Het probably benign phenotype 04/05/2018
79 511561 UTSW Morn4 0.131 FR4449 217.73 N 19 42076109 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG small insertion Het probably benign 04/05/2018
80 511477 UTSW Nat8f2 0.221 FR4449 222 N 6 85867686 L231F T A missense Homo possibly damaging 0.838 04/05/2018
81 511465 UTSW Noc2l 1.000 FR4449 144.47 N 4 156240101 C CTGA small insertion Het probably benign phenotype 04/05/2018
82 511531 UTSW Nrg3 0.484 FR4449 166.49 N 14 38397271 T TAGACAC small insertion Het probably benign phenotype 04/05/2018
83 511496 UTSW Olfr890 0.086 FR4449 222 N 9 38143188 I13V A G missense Homo probably benign 0.004 phenotype 04/05/2018
84 511492 UTSW Piezo1 1.000 FR4449 222 N 8 122495569 R503W G A missense Homo probably damaging 1.000 0.400 phenotype 04/05/2018
85 511498 UTSW Pih1d2 0.089 FR4449 214.46 N 9 50621627 CTCTTGCGAGGATC CTC frame shift Homo probably null 04/05/2018
86 511560 UTSW Pik3ap1 0.000 FR4449 217.5 N 19 41281946 G GGAA small insertion Het probably benign phenotype 04/05/2018
87 511563 UTSW Ppp1r3f 0.014 FR4449 222 N X 7560336 G562V C A missense Homo probably damaging 1.000 0.247 phenotype 04/05/2018
88 511478 UTSW Ptms FR4449 181.47 N 6 124914459 TTC TTCGTC unclassified Het probably benign 04/05/2018
89 511503 UTSW Ptpn23 1.000 FR4449 222 N 9 110387633 P1052T G T missense Homo probably benign 0.150 phenotype 04/05/2018
90 511524 UTSW Qrich2 0.166 FR4449 191.46 N 11 116456199 AACT A small deletion Homo probably benign 04/05/2018
91 511504 UTSW Raet1d 0.046 FR4449 217.47 N 10 22370915 A ATATCCTCTCTGG small insertion Het probably benign 04/05/2018
92 511467 UTSW Rbm33 0.579 FR4449 214.46 N 5 28394168 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA small deletion Homo probably benign 04/05/2018
93 511448 UTSW Rrbp1 0.260 FR4449 199.47 N 2 143967456 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC frame shift Het probably null 04/05/2018
94 511539 UTSW Sbp 0.103 FR4449 217.47 N 17 23945364 CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA small insertion Het probably benign 04/05/2018
95 511484 UTSW Setd1a 1.000 FR4449 86.01 N 7 127785326 G A unclassified Het probably benign phenotype 04/05/2018
96 511472 UTSW Sfswap 0.000 FR4449 217.47 N 5 129569748 CCCACTCAG CCCACTCAGTCCACTCAG unclassified Het probably benign phenotype 04/05/2018
97 511473 UTSW Sfswap 0.000 FR4449 217.47 N 5 129569749 CCACTCAGC CCACTCAGCTCACTCAGC unclassified Het probably benign phenotype 04/05/2018
98 511510 UTSW Sh3pxd2b 0.596 FR4449 216.23 N 11 32423065 T TGTCTGC small insertion Homo probably benign phenotype 04/05/2018
99 511552 UTSW Six3 1.000 FR4449 158.47 N 17 85621362 CGG CGGGGG small insertion Het probably benign phenotype 04/05/2018
100 511446 UTSW Slc12a1 0.388 FR4449 214.46 N 2 125154216 C CTTTGGCCACAACACG small insertion Homo probably benign phenotype 04/05/2018
[records 1 to 100 of 129] next >> last >|