Incidental Mutations

86 incidental mutations are currently displayed, and affect 86 genes.
14 are Possibly Damaging.
30 are Probably Damaging.
35 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 61363 UTSW Abca8b 0.000 R0690 G1 150 Y 11 109969808 T A splice site Het probably benign phenotype 07/30/2013
2 61361 UTSW Abi3 0.000 R0690 G1 152 Y 11 95833634 T C unclassified Het probably benign phenotype 07/30/2013
3 61366 UTSW Adam2 0.000 R0690 G1 201 Y 14 66057646 N250S T C missense Het probably damaging 0.996 0.072 phenotype 07/30/2013
4 61324 UTSW Agbl4 0.000 R0690 G1 193 Y 4 111657388 I532K T A missense Het probably benign 0.354 0.128 phenotype 07/30/2013
5 61329 UTSW Agrn 0.599 R0690 G1 99 Y 4 156174453 E905A T G missense Het probably damaging 0.998 0.054 phenotype 07/30/2013
6 61356 UTSW Ahi1 0.835 R0690 G1 82 Y 10 20970843 A G splice site Het probably benign phenotype 07/30/2013
7 218535 UTSW Aifm2 0.106 R0690 G1 69 Y 10 61726452 N89S A G missense Het probably benign 0.011 0.120 phenotype 08/18/2014
8 61321 UTSW Arsj 0.069 R0690 G1 144 Y 3 126438184 T193I C T missense Het probably damaging 0.992 0.128 phenotype 07/30/2013
9 61357 UTSW Ascc2 1.000 R0690 G1 176 Y 11 4682933 V702E T A missense Het probably damaging 1.000 0.282 07/30/2013
10 61309 UTSW Avpr1b 0.074 R0690 G1 140 Y 1 131600281 S181P T C missense Het probably damaging 0.992 0.198 phenotype 07/30/2013
11 61332 UTSW Bcl7a 1.000 R0690 G1 143 Y 5 123351940 V56I G A missense Het possibly damaging 0.819 0.164 phenotype 07/30/2013
12 61319 UTSW Cd160 0.081 R0690 G1 81 Y 3 96805786 D54V T A missense Het probably damaging 0.990 0.033 phenotype 07/30/2013
13 61320 UTSW Celsr2 0.000 R0690 G1 195 Y 3 108414977 R173M C A missense Het probably damaging 0.999 0.206 phenotype 07/30/2013
14 61326 UTSW Cfap57 0.000 R0690 G1 95 Y 4 118569727 A G splice site Het probably benign 0.126 phenotype 07/30/2013
15 61330 UTSW Cfap69 0.000 R0690 G1 84 Y 5 5663951 T27I G A missense Het probably damaging 0.991 0.029 phenotype 07/30/2013
16 218538 UTSW Chaf1b 0.954 R0690 G1 57 Y 16 93900017 T C splice site Het probably benign phenotype 08/18/2014
17 61368 UTSW Cldn8 0.223 R0690 G1 164 Y 16 88562639 V133M C T missense Het probably damaging 1.000 0.186 phenotype 07/30/2013
18 218537 UTSW Col2a1 1.000 R0690 G1 28 Y 15 97980192 V954E A T missense Het unknown 0.050 phenotype 08/18/2014
19 61354 UTSW Col6a4 0.000 R0690 G1 162 Y 9 106028187 T C splice site Het probably benign 0.088 07/30/2013
20 61353 UTSW Col6a6 0.111 R0690 G1 166 Y 9 105709486 M1779V T C missense Het probably benign 0.011 0.090 07/30/2013
21 61340 UTSW Coq8b 1.000 R0690 G1 166 Y 7 27242249 E253G A G missense Het probably benign 0.154 0.110 phenotype 07/30/2013
22 61310 UTSW Ctse 0.000 R0690 G1 151 Y 1 131674778 T C splice site Het probably benign 0.105 phenotype 07/30/2013
23 61376 UTSW Cyp2c29 0.079 R0690 G1 161 Y 19 39309726 N238K T A missense Het probably benign 0.001 0.128 07/30/2013
24 218534 UTSW Dcaf1 1.000 R0690 G1 51 Y 9 106846649 T A splice site Het probably benign phenotype 08/18/2014
25 61372 UTSW Dcc 1.000 R0690 G1 154 Y 18 71809204 A T splice site Het probably benign 0.122 phenotype 07/30/2013
26 61375 UTSW Dkk1 1.000 R0690 G1 122 Y 19 30549345 F12S A G missense Het probably benign 0.187 0.116 phenotype 07/30/2013
27 61335 UTSW Dnah6 0.141 R0690 G1 108 Y 6 73129474 V1760A A G missense Het probably benign 0.006 0.062 phenotype 07/30/2013
28 61307 UTSW Fam117b 0.163 R0690 G1 181 Y 1 59958353 S288N G A missense Het possibly damaging 0.653 0.398 07/30/2013
29 61331 UTSW Fam216a 0.000 R0690 G1 127 Y 5 122367646 M110K A T missense Het probably damaging 0.996 0.284 07/30/2013
30 61348 UTSW Frem3 0.108 R0690 G1 195 Y 8 80613952 I958N T A missense Het possibly damaging 0.842 0.340 phenotype 07/30/2013
31 61349 UTSW Gab1 1.000 R0690 G1 141 Y 8 80800116 N118Y T A missense Het probably damaging 1.000 0.466 phenotype 07/30/2013
32 61374 UTSW Gda 0.000 R0690 G1 107 Y 19 21409887 I251L T A missense Het probably benign 0.000 0.196 phenotype 07/30/2013
33 61308 UTSW Gli2 1.000 R0690 G1 200 Y 1 118844460 R505L C A missense Het probably damaging 1.000 0.418 phenotype 07/30/2013
34 61370 UTSW Gm5093 0.336 R0690 G1 137 N 17 46439738 I121N A T missense Het possibly damaging 0.530 07/30/2013
35 61334 UTSW Gpnmb 0.000 R0690 G1 171 Y 6 49048015 S327L C T missense Het probably benign 0.242 0.156 phenotype 07/30/2013
36 61367 UTSW Gpr156 0.000 R0690 G1 222 Y 16 37992141 Y280N T A missense Het probably damaging 1.000 0.128 phenotype 07/30/2013
37 218532 UTSW Gria4 0.615 R0690 G1 49 Y 9 4427071 Y790H A G missense Het probably damaging 1.000 0.194 phenotype 08/18/2014
38 218529 UTSW Guf1 0.700 R0690 G1 48 Y 5 69566352 C A intron Het probably null 0.612 phenotype 08/18/2014
39 61328 UTSW H6pd 0.127 R0690 G1 113 Y 4 149982573 E452G T C missense Het possibly damaging 0.929 0.172 phenotype 07/30/2013
40 61351 UTSW Herc1 0.000 R0690 G1 151 Y 9 66386838 Y487* T A nonsense Het probably null 0.606 phenotype 07/30/2013
41 61346 UTSW Ifi30 R0690 G1 86 Y 8 70764949 T A unclassified Het probably benign 0.065 phenotype 07/30/2013
42 61342 UTSW Klf13 0.373 R0690 G1 99 Y 7 63938071 A159V G A missense Het possibly damaging 0.801 0.050 phenotype 07/30/2013
43 61359 UTSW Med11 1.000 R0690 G1 152 Y 11 70453226 M124K T A missense Het possibly damaging 0.854 0.210 phenotype 07/30/2013
44 218527 UTSW Myom3 0.130 R0690 G1 62 Y 4 135788426 A G splice site Het probably benign 0.118 08/18/2014
45 61345 UTSW Nat2 0.630 R0690 G1 134 Y 8 67501804 I189F A T missense Het probably damaging 0.999 0.034 phenotype 07/30/2013
46 218539 UTSW Nhlrc4 0.080 R0690 G1 76 Y 17 25943684 G30R C G missense Het probably damaging 1.000 0.106 08/18/2014
47 218528 UTSW Nkx3-2 1.000 R0690 G1 37 Y 5 41762127 R173C G A missense Het probably damaging 0.984 0.080 phenotype 08/18/2014
48 61369 UTSW Nox3 0.362 R0690 G1 118 Y 17 3695564 N23S T C missense Het probably damaging 1.000 0.136 phenotype 07/30/2013
49 61322 UTSW Npr2 0.793 R0690 G1 123 Y 4 43646991 Y708F A T missense Het probably damaging 0.980 0.118 phenotype 07/30/2013
50 61365 UTSW Nsun2 0.881 R0690 G1 173 Y 13 69629542 N409S A G missense Het probably benign 0.000 0.050 phenotype 07/30/2013
51 61343 UTSW Nucb2 0.181 R0690 G1 85 Y 7 116535851 T C splice site Het probably benign phenotype 07/30/2013
52 61315 UTSW Olfr1105 0.077 R0690 G1 92 N 2 87033882 F113S A G missense Het probably damaging 0.998 phenotype 07/30/2013
53 218531 UTSW Olfr541 0.063 R0690 G1 79 Y 7 140704787 F179L T C missense Het possibly damaging 0.879 0.374 phenotype 08/18/2014
54 218533 UTSW Olfr874 0.076 R0690 G1 34 Y 9 37746217 F28L T C missense Het probably benign 0.008 0.182 phenotype 08/18/2014
55 218530 UTSW Orai2 0.075 R0690 G1 80 Y 5 136161599 V52D A T missense Het probably damaging 0.999 0.236 phenotype 08/18/2014
56 61336 UTSW Pcyox1 0.000 R0690 G1 148 Y 6 86394442 M154K A T missense Het probably damaging 1.000 0.334 phenotype 07/30/2013
57 61352 UTSW Pik3r4 1.000 R0690 G1 152 Y 9 105653976 T492K C A missense Het possibly damaging 0.810 0.332 phenotype 07/30/2013
58 61313 UTSW Pmpca 0.948 R0690 G1 132 Y 2 26391097 Y150N T A missense Het probably damaging 1.000 0.386 phenotype 07/30/2013
59 61311 UTSW Ppp1r12b 0.304 R0690 G1 168 Y 1 134876082 S446R G T missense Het probably damaging 0.999 0.294 07/30/2013
60 61364 UTSW Ptpdc1 0.000 R0690 G1 199 Y 13 48586905 I289T A G missense Het probably benign 0.334 0.146 phenotype 07/30/2013
61 61377 UTSW Pyroxd2 0.096 R0690 G1 130 Y 19 42727642 A G splice site Het probably benign 0.156 07/30/2013
62 61317 UTSW Qrfpr 0.000 R0690 G1 154 Y 3 36189559 T131M G A missense Het probably damaging 0.997 0.030 phenotype 07/30/2013
63 218526 UTSW Rab33b 0.147 R0690 G1 66 Y 3 51493417 Y104C A G missense Het probably damaging 1.000 0.396 phenotype 08/18/2014
64 61325 UTSW Rad54l 0.000 R0690 G1 225 Y 4 116099750 G T splice site Het probably benign 0.100 phenotype 07/30/2013
65 61373 UTSW Rad9a 1.000 R0690 G1 181 Y 19 4197360 A T unclassified 1941 bp Het probably null 0.166 phenotype 07/30/2013
66 61339 UTSW Slc1a5 0.266 R0690 G1 136 Y 7 16786904 M233L A T missense Het probably benign 0.000 0.113 phenotype 07/30/2013
67 218536 UTSW Slc47a2 0.000 R0690 G1 56 Y 11 61342504 V67I C T missense Het possibly damaging 0.622 0.085 08/18/2014
68 61337 UTSW Slco1a5 0.067 R0690 G1 161 Y 6 142268278 Y39F T A missense Het probably benign 0.244 0.068 phenotype 07/30/2013
69 61360 UTSW Slfn5 0.088 R0690 G1 177 Y 11 82961403 V785A T C missense Het probably damaging 0.997 0.160 07/30/2013
70 61362 UTSW Sp6 0.572 R0690 G1 87 Y 11 97021544 P28S C T missense Het possibly damaging 0.891 0.204 phenotype 07/30/2013
71 61316 UTSW Sptbn5 0.299 R0690 G1 128 Y 2 120062675 A G unclassified 2 bp Het probably null 0.578 07/30/2013
72 61378 UTSW Sry 0.318 R0690 G1 113 N Y 2662944 ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 07/30/2013
73 61338 UTSW St8sia1 0.059 R0690 G1 138 Y 6 142829254 W200R A G missense Het probably damaging 1.000 0.098 phenotype 07/30/2013
74 61314 UTSW Stxbp1 0.741 R0690 G1 134 Y 2 32800695 C A splice site Het probably benign phenotype 07/30/2013
75 61355 UTSW Syne1 1.000 R0690 G1 106 Y 10 5033138 A G splice site Het probably benign phenotype 07/30/2013
76 61318 UTSW Thbs3 0.818 R0690 G1 160 Y 3 89220165 I371N T A missense Het possibly damaging 0.500 0.456 phenotype 07/30/2013
77 61344 UTSW Tll1 1.000 R0690 G1 196 Y 8 64074290 S399N C T missense Het probably damaging 0.989 0.178 phenotype 07/30/2013
78 61333 UTSW Tmem209 0.341 R0690 G1 84 Y 6 30505834 C114G A C missense Het probably null 0.999 0.240 07/30/2013
79 61350 UTSW Tmem25 0.063 R0690 G1 225 Y 9 44795514 C T unclassified Het probably benign 0.079 07/30/2013
80 61323 UTSW Tmem8b 0.119 R0690 G1 93 Y 4 43674562 I282T T C missense Het possibly damaging 0.691 0.062 07/30/2013
81 61312 UTSW Trdmt1 0.320 R0690 G1 130 Y 2 13544580 H18L T A missense Het probably benign 0.015 0.192 phenotype 07/30/2013
82 61327 UTSW Trim63 0.000 R0690 G1 143 Y 4 134316405 T60A A G missense Het probably benign 0.005 0.048 phenotype 07/30/2013
83 61358 UTSW Trpv2 0.257 R0690 G1 157 Y 11 62584676 T C critical splice donor site 2 bp Het probably null 0.478 phenotype 07/30/2013
84 61371 UTSW Ubr2 0.882 R0690 G1 81 Y 17 46938653 I1591K A T missense Het probably damaging 0.970 0.272 phenotype 07/30/2013
85 61347 UTSW Use1 1.000 R0690 G1 147 Y 8 71367065 A T utr 5 prime Het probably benign 0.066 phenotype 07/30/2013
86 61341 UTSW Zfp850 0.064 R0690 G1 120 Y 7 27985217 C35S A T missense Het possibly damaging 0.672 0.362 07/30/2013
[records 1 to 86 of 86]