Incidental Mutations

74 incidental mutations are currently displayed, and affect 73 genes.
17 are Possibly Damaging.
24 are Probably Damaging.
21 are Probably Benign.
10 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 74 of 74] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 187283 UTSW Adgra1 0.173 R1667 G1 225 Y 7 139845648 A26T G A missense Het possibly damaging 0.950 0.268 phenotype 05/09/2014
2 187293 UTSW Adgrg3 0.000 R1667 G1 225 Y 8 95033373 Y73* T A nonsense Het probably null 0.616 phenotype 05/09/2014
3 187322 UTSW Alk 0.204 R1667 G1 225 Y 17 71911567 V761E A T missense Het probably damaging 1.000 0.266 phenotype 05/09/2014
4 187276 UTSW Ankrd13a 0.112 R1667 G1 219 Y 5 114786733 V93A T C missense Het possibly damaging 0.888 0.134 05/09/2014
5 187300 UTSW Anks1b 0.000 R1667 G1 225 Y 10 90511184 T C critical splice donor site 2 bp Het probably null 0.488 phenotype 05/09/2014
6 187299 UTSW Ascl1 1.000 R1667 G1 94 Y 10 87492793 N99S T C missense Het probably benign 0.094 0.096 phenotype 05/09/2014
7 187295 UTSW Atm 0.721 R1667 G1 225 Y 9 53500932 L972Q A T missense Het probably damaging 1.000 0.244 phenotype 05/09/2014
8 187296 UTSW Atp2c1 0.408 R1667 G1 225 Y 9 105432797 L566Q A T missense Het probably null 0.935 0.132 phenotype 05/09/2014
9 187267 UTSW Bank1 0.066 R1667 G1 225 Y 3 136093296 Y629F T A missense Het probably damaging 1.000 0.130 phenotype 05/09/2014
10 187275 UTSW Bod1l 0.933 R1667 G1 225 Y 5 41816775 L2399I G T missense Het probably benign 0.014 0.012 05/09/2014
11 187260 UTSW Bub1b 1.000 R1667 G1 225 Y 2 118641189 G1010D G A missense Het probably benign 0.002 0.123 phenotype 05/09/2014
12 187290 UTSW Ces1b 0.074 R1667 G1 225 Y 8 93056904 H563Y G A missense Het possibly damaging 0.748 0.065 05/09/2014
13 187314 UTSW Cfap70 0.077 R1667 G1 225 Y 14 20404157 E853G T C missense Het probably benign 0.415 0.115 05/09/2014
14 187254 UTSW Cfh 0.129 R1667 G1 225 Y 1 140105523 E779G T C missense Het probably benign 0.015 0.162 phenotype 05/09/2014
15 187311 UTSW Cox7c 1.000 R1667 G1 225 N 13 86045884 S7P A G missense Het probably benign 0.013 05/09/2014
16 187327 UTSW Cyp2c67 0.084 R1667 G1 225 Y 19 39643590 A G critical splice donor site 2 bp Het probably null 0.556 05/09/2014
17 187297 UTSW Dhx30 1.000 R1667 G1 225 Y 9 110085445 L995I G T missense Het possibly damaging 0.912 0.061 phenotype 05/09/2014
18 187298 UTSW Dhx30 1.000 R1667 G1 225 Y 9 110085446 N957K G C missense Het possibly damaging 0.479 0.078 phenotype 05/09/2014
19 187323 UTSW Dsc3 1.000 R1667 G1 225 Y 18 19991560 T36A T C missense Het possibly damaging 0.580 0.062 phenotype 05/09/2014
20 187253 UTSW Dstyk 0.229 R1667 G1 225 Y 1 132456919 D717G A G missense Het probably damaging 1.000 0.414 phenotype 05/09/2014
21 187255 UTSW Dusp10 0.660 R1667 G1 225 Y 1 184036858 D7G A G missense Het probably damaging 0.995 0.158 phenotype 05/09/2014
22 187321 UTSW E230001N04Rik 0.167 R1667 G1 225 Y 17 28523961 T G exon Het noncoding transcript 0.072 05/09/2014
23 187319 UTSW Ece2 0.000 R1667 G1 225 Y 16 20637838 S330P T C missense Het possibly damaging 0.780 0.036 phenotype 05/09/2014
24 187310 UTSW Fam172a 0.174 R1667 G1 225 Y 13 77759516 M1K T A start codon destroyed Het probably null 0.041 0.626 phenotype 05/09/2014
25 187262 UTSW Frmd5 0.000 R1667 G1 150 Y 2 121548730 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC frame shift Het probably null 0.633 05/09/2014
26 187256 UTSW Gata3 1.000 R1667 G1 225 Y 2 9877549 H14R T C missense Het possibly damaging 0.948 0.220 phenotype 05/09/2014
27 187257 UTSW Ggta1 0.000 R1667 G1 225 Y 2 35414283 I75F T A missense Het possibly damaging 0.835 0.066 phenotype 05/09/2014
28 187313 UTSW Hcn1 0.000 R1667 G1 225 Y 13 117603073 I124F A T missense Het unknown 0.358 phenotype 05/09/2014
29 187292 UTSW Herpud1 0.197 R1667 G1 225 Y 8 94389366 D53A A C missense Het probably damaging 1.000 0.382 phenotype 05/09/2014
30 187309 UTSW Inhba 1.000 R1667 G1 225 Y 13 16026624 L257Q T A missense Het possibly damaging 0.900 0.108 phenotype 05/09/2014
31 187266 UTSW Itga10 0.243 R1667 G1 225 Y 3 96651738 C T splice site Het probably benign 0.164 phenotype 05/09/2014
32 187312 UTSW Jmy 0.186 R1667 G1 196 Y 13 93498370 S313C T A missense Het probably damaging 1.000 0.266 05/09/2014
33 187304 UTSW Lpo 0.000 R1667 G1 225 Y 11 87807241 G A unclassified Het probably benign phenotype 05/09/2014
34 187320 UTSW Lsg1 0.950 R1667 G1 225 Y 16 30571352 E315G T C missense Het probably damaging 0.999 0.192 phenotype 05/09/2014
35 187280 UTSW Lsm14a 0.577 R1667 G1 225 Y 7 34365654 T167S T A missense Het possibly damaging 0.925 0.210 phenotype 05/09/2014
36 187307 UTSW Lsmem1 0.073 R1667 G1 197 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 05/09/2014
37 187324 UTSW Map3k2 0.000 R1667 G1 225 Y 18 32203792 T C splice site Het probably benign phenotype 05/09/2014
38 187318 UTSW Mapk12 0.000 R1667 G1 225 Y 15 89140141 M81K A T missense Het probably damaging 0.999 0.458 phenotype 05/09/2014
39 187317 UTSW Matn2 0.000 R1667 G1 225 Y 15 34378732 C305S T A missense Het probably damaging 0.991 0.488 phenotype 05/09/2014
40 187278 UTSW Mgam 0.108 R1667 G1 225 Y 6 40677044 Y844H T C missense Het possibly damaging 0.619 0.174 phenotype 05/09/2014
41 187306 UTSW Mgat5b 0.108 R1667 G1 225 Y 11 116947377 R281G A G missense Het probably benign 0.001 0.056 phenotype 05/09/2014
42 187294 UTSW Mon1b 0.081 R1667 G1 225 Y 8 113641957 C497G T G missense Het probably damaging 0.990 0.236 05/09/2014
43 187303 UTSW Mybbp1a 1.000 R1667 G1 225 Y 11 72445217 H452L A T missense Het probably benign 0.002 0.118 phenotype 05/09/2014
44 187263 UTSW Mybl2 1.000 R1667 G1 225 Y 2 163075696 T41A A G missense Het probably damaging 0.996 0.298 phenotype 05/09/2014
45 187264 UTSW Ncoa5 1.000 R1667 G1 225 Y 2 165001703 V540A A G missense Het probably damaging 1.000 0.316 phenotype 05/09/2014
46 187291 UTSW Nup93 0.927 R1667 G1 225 Y 8 94292687 V47E T A missense Het possibly damaging 0.712 0.092 phenotype 05/09/2014
47 187259 UTSW Olfr1052 0.072 R1667 G1 225 Y 2 86298736 M307V A G missense Het probably null 0.020 0.110 phenotype 05/09/2014
48 187282 UTSW Olfr17 0.092 R1667 G1 225 Y 7 107097770 M102L A T missense Het probably benign 0.002 0.232 phenotype 05/09/2014
49 187289 UTSW Orc6 1.000 R1667 G1 225 Y 8 85305285 C100S T A missense Het possibly damaging 0.936 0.318 phenotype 05/09/2014
50 187301 UTSW Otogl 0.000 R1667 G1 225 Y 10 107813965 Y1176* G T nonsense Het probably null 0.600 phenotype 05/09/2014
51 187268 UTSW Patj 0.000 R1667 G1 225 Y 4 98413027 D183V A T missense Het probably damaging 1.000 0.396 phenotype 05/09/2014
52 187271 UTSW Pik3r3 0.251 R1667 G1 225 Y 4 116222317 T4A A G missense Het probably damaging 0.990 0.246 phenotype 05/09/2014
53 187261 UTSW Pla2g4d 0.063 R1667 G1 225 Y 2 120270150 G A splice site Het probably benign phenotype 05/09/2014
54 187258 UTSW Pla2r1 0.000 R1667 G1 225 Y 2 60420257 I1407T A G missense Het probably benign 0.001 0.006 phenotype 05/09/2014
55 187273 UTSW Pramef12 0.056 R1667 G1 225 Y 4 144393036 C320* A T nonsense Het probably null 0.619 05/09/2014
56 187249 UTSW Prex2 0.337 R1667 G1 225 Y 1 11186757 H1231L A T missense Het probably benign 0.000 0.118 phenotype 05/09/2014
57 187305 UTSW Prkca 0.337 R1667 G1 225 Y 11 107983946 V390A A G missense Het probably damaging 1.000 0.132 phenotype 05/09/2014
58 187284 UTSW Psmd13 0.944 R1667 G1 188 Y 7 140890609 W255R T A missense Het probably damaging 0.999 0.392 phenotype 05/09/2014
59 187316 UTSW Rec8 0.000 R1667 G1 225 Y 14 55618796 N37K T A missense Het probably damaging 0.999 0.198 phenotype 05/09/2014
60 187274 UTSW Rnf207 0.108 R1667 G1 174 Y 4 152313215 E361K C T missense Het probably benign 0.002 0.052 05/09/2014
61 187308 UTSW Serpina3f 0.064 R1667 G1 225 Y 12 104217440 L187Q T A missense Het probably damaging 1.000 0.053 05/09/2014
62 187270 UTSW Skint11 0.073 R1667 G1 225 Y 4 114194781 T109S A T missense Het probably damaging 0.985 0.031 05/09/2014
63 187315 UTSW Slc7a8 0.527 R1667 G1 209 Y 14 54724849 S443P A G missense Het probably damaging 1.000 0.224 phenotype 05/09/2014
64 187277 UTSW Slc8b1 0.000 R1667 G1 195 Y 5 120521082 F197Y T A missense Het probably benign 0.386 0.140 phenotype 05/09/2014
65 269783 UTSW Sox2 1.000 R1667 G1 38 Y 3 34650419 Y2H T C missense Het probably damaging 1.000 0.282 phenotype 03/13/2015
66 187250 UTSW Speg 1.000 R1667 G1 225 Y 1 75410549 T A splice site Het probably benign phenotype 05/09/2014
67 187285 UTSW Tlr3 0.108 R1667 G1 225 Y 8 45400837 N149D T C missense Het probably benign 0.001 0.148 phenotype 05/09/2014
68 187287 UTSW Trim60 0.064 R1667 G1 225 Y 8 65001464 D44E A C missense Het probably benign 0.003 0.106 phenotype 05/09/2014
69 187252 UTSW Ugt1a7c 0.083 R1667 G1 225 Y 1 88095935 Y272C A G missense Het probably damaging 0.974 0.075 05/09/2014
70 187279 UTSW Vmn1r4 0.057 R1667 G1 225 Y 6 56956753 Y81N T A missense Het probably damaging 0.978 0.028 05/09/2014
71 187281 UTSW Vmn2r73 0.131 R1667 G1 225 Y 7 85857681 C808S A T missense Het probably benign 0.001 0.116 05/09/2014
72 187265 UTSW Ythdf3 0.408 R1667 G1 225 Y 3 16204892 I412T T C missense Het possibly damaging 0.462 0.266 phenotype 05/09/2014
73 187302 UTSW Zfp672 0.097 R1667 G1 225 Y 11 58316095 T467A T C missense Het possibly damaging 0.528 0.060 05/09/2014
74 269784 UTSW Zfp985 0.271 R1667 G1 36 Y 4 147583950 Q425L A T missense Het possibly damaging 0.844 0.070 03/13/2015
[records 1 to 74 of 74]