Incidental Mutations

224 incidental mutations are currently displayed, and affect 151 genes.
29 are Possibly Damaging.
46 are Probably Damaging.
136 are Probably Benign.
11 are Probably Null.
6 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 224] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 198611 UTSW 4930447A16Rik 0.052 R1728 G1 206 N 15 37439600 G A intron Het probably benign 05/23/2014
2 198572 UTSW Aadat 0.000 R1728 G1 225 N 8 60526712 T203A A G missense Het probably damaging 0.997 phenotype 05/23/2014
3 198590 UTSW Abca13 0.123 R1728 G1 225 N 11 9249680 F104L T A missense Het probably benign 0.020 phenotype 05/23/2014
4 198599 UTSW Acox1 0.383 R1728 G1 225 N 11 116198283 T A unclassified Het probably null phenotype 05/23/2014
5 198565 UTSW Adamts17 0.151 R1728 G1 225 N 7 67149956 R1060* C T nonsense Het probably null phenotype 05/23/2014
6 198585 UTSW Adgrg6 1.000 R1728 G1 225 N 10 14439782 T593A T C missense Het probably damaging 1.000 phenotype 05/23/2014
7 198622 UTSW Ankrd12 0.250 R1728 G1 225 N 17 65984076 P1454Q G T missense Het probably benign 0.012 phenotype 05/23/2014
8 198616 UTSW Ap2m1 1.000 R1728 G1 225 N 16 20539338 N35K T A missense Het probably damaging 0.991 phenotype 05/23/2014
9 198523 UTSW Aspm 0.000 R1728 G1 225 N 1 139473574 I1111V A G missense Het probably benign 0.000 phenotype 05/23/2014
10 198582 UTSW Atr 1.000 R1728 G1 225 N 9 95897581 V1331I G A missense Het probably benign 0.014 phenotype 05/23/2014
11 198543 UTSW Bola1 0.147 R1728 G1 206 N 3 96197110 G56D C T missense Het probably benign 0.000 05/23/2014
12 198562 UTSW Brsk1 0.000 R1728 G1 225 N 7 4704219 D257G A G missense Het probably damaging 0.999 phenotype 05/23/2014
13 198341 UTSW C4bp 0.017 R1728 G1 225 N 1 130642988 V284L C G missense Het probably benign 0.040 05/23/2014
14 198484 UTSW Cacna1s 1.000 R1728 G1 225 N 1 136118716 F1761S T C missense Het probably benign 0.000 phenotype 05/23/2014
15 198495 UTSW Camsap2 0.564 R1728 G1 225 N 1 136281315 R802Q C T missense Het probably benign 0.001 05/23/2014
16 198621 UTSW Cbs 0.585 R1728 G1 225 N 17 31620949 A337E G T missense Het probably benign 0.353 phenotype 05/23/2014
17 198559 UTSW Ccdc129 0.025 R1728 G1 225 N 6 55968541 F749S T C missense Het probably benign 0.006 05/23/2014
18 198625 UTSW Ccdc186 0.502 R1728 G1 225 N 19 56809220 H306Q A C missense Het probably benign 0.035 05/23/2014
19 198324 UTSW Ccdc93 0.188 R1728 G1 120 N 1 121456126 P192L C T missense Het probably benign 0.000 05/23/2014
20 198325 UTSW Ccdc93 0.188 R1728 G1 154 N 1 121461939 V237A T C missense Het probably benign 0.000 05/23/2014
21 198335 UTSW Cd55 0.000 R1728 G1 225 N 1 130449423 V333I C T missense Het probably benign 0.316 0.128 phenotype 05/23/2014
22 198337 UTSW Cd55 0.000 R1728 G1 225 N 1 130459633 A143S C A missense Het probably benign 0.000 phenotype 05/23/2014
23 198304 UTSW Cdh19 0.033 R1728 G1 225 N 1 110893384 E541D C A missense Het probably damaging 0.977 phenotype 05/23/2014
24 198303 UTSW Cdh7 0.118 R1728 G1 225 N 1 110065735 L307V C G missense Het possibly damaging 0.534 phenotype 05/23/2014
25 198526 UTSW Cfh 0.105 R1728 G1 225 N 1 140147697 V268I C T missense Het possibly damaging 0.554 phenotype 05/23/2014
26 198524 UTSW Cfhr2 0.058 R1728 G1 225 N 1 139813442 M265T A G missense Het probably benign 0.001 05/23/2014
27 198525 UTSW Cfhr2 0.058 R1728 G1 225 N 1 139813459 N259K A C missense Het probably benign 0.017 05/23/2014
28 198410 UTSW Chil1 0.090 R1728 G1 225 N 1 134188529 A250V C T missense Het probably damaging 0.998 phenotype 05/23/2014
29 198592 UTSW Chrnb1 0.237 R1728 G1 225 N 11 69785762 D388Y C A missense Het probably damaging 1.000 phenotype 05/23/2014
30 198557 UTSW Clcn1 0.682 R1728 G1 225 N 6 42299514 F360Y T A missense Het possibly damaging 0.856 phenotype 05/23/2014
31 198574 UTSW Clgn 0.377 R1728 G1 225 N 8 83423030 S387G A G missense Het probably damaging 0.983 phenotype 05/23/2014
32 198308 UTSW Cntnap5a 0.157 R1728 G1 225 N 1 116455004 L1001I C A missense Het probably benign 0.001 phenotype 05/23/2014
33 198309 UTSW Cntnap5a 0.157 R1728 G1 225 N 1 116455101 L1033S T C missense Het probably benign 0.001 phenotype 05/23/2014
34 198310 UTSW Cntnap5a 0.157 R1728 G1 225 N 1 116455143 T1047I C T missense Het probably benign 0.015 phenotype 05/23/2014
35 198597 UTSW Coil 0.248 R1728 G1 201 N 11 88973976 V10I G A missense Het probably damaging 0.981 phenotype 05/23/2014
36 198569 UTSW Col4a1 1.000 R1728 G1 225 N 8 11212712 P1256S G A missense Het possibly damaging 0.815 phenotype 05/23/2014
37 198534 UTSW Copa 0.981 R1728 G1 225 N 1 172111987 F597Y T A missense Het probably benign 0.000 phenotype 05/23/2014
38 198518 UTSW Crb1 0.250 R1728 G1 225 N 1 139234779 M1214V T C missense Het probably benign 0.000 phenotype 05/23/2014
39 198519 UTSW Crb1 0.250 R1728 G1 225 N 1 139237622 H921Q A T missense Het probably benign 0.001 phenotype 05/23/2014
40 198520 UTSW Crb1 0.250 R1728 G1 225 N 1 139241138 P881S G A missense Het probably damaging 0.997 phenotype 05/23/2014
41 198521 UTSW Crb1 0.250 R1728 G1 225 N 1 139242995 G825R C T missense Het probably damaging 1.000 phenotype 05/23/2014
42 198522 UTSW Crb1 0.250 R1728 G1 225 N 1 139243417 R684H C T missense Het probably benign 0.005 phenotype 05/23/2014
43 198586 UTSW Crybg1 0.194 R1728 G1 146 N 10 44004019 Q391L T A missense Het probably damaging 0.968 05/23/2014
44 198580 UTSW Cspg4 0.000 R1728 G1 225 N 9 56898537 V2211L G T missense Het probably benign 0.001 phenotype 05/23/2014
45 198327 UTSW Cxcr4 0.747 R1728 G1 225 N 1 128589277 V216I C T missense Het probably benign 0.001 phenotype 05/23/2014
46 198416 UTSW Cyb5r1 0.174 R1728 G1 225 N 1 134407667 R147W C T missense Het probably damaging 1.000 05/23/2014
47 198497 UTSW Ddx59 0.953 R1728 G1 225 N 1 136417053 V154A T C missense Het probably benign 0.000 05/23/2014
48 198584 UTSW Dhx30 0.936 R1728 G1 225 N 9 110098751 H101R T C missense Het probably damaging 0.976 phenotype 05/23/2014
49 198604 UTSW Dnah11 0.453 R1728 G1 225 N 12 117916931 D3818V T A missense Het probably damaging 1.000 phenotype 05/23/2014
50 198600 UTSW Dnah17 0.378 R1728 G1 225 N 11 118069519 C2572Y C T missense Het possibly damaging 0.759 phenotype 05/23/2014
51 198305 UTSW Dsel 0.211 R1728 G1 225 N 1 111859457 N1116S T C missense Het probably benign 0.000 0.136 phenotype 05/23/2014
52 198306 UTSW Dsel 0.211 R1728 G1 225 N 1 111859994 T937S G C missense Het probably benign 0.000 phenotype 05/23/2014
53 198372 UTSW Dstyk 0.235 R1728 G1 109 N 1 132456984 L739F C T missense Het probably damaging 1.000 phenotype 05/23/2014
54 198539 UTSW Ehf 0.586 R1728 G1 225 N 2 103273906 T186P T G missense Het possibly damaging 0.513 phenotype 05/23/2014
55 198323 UTSW En1 1.000 R1728 G1 183 N 1 120603621 S197G A G missense Het unknown phenotype 05/23/2014
56 198390 UTSW Etnk2 0.260 R1728 G1 131 N 1 133365587 D89E C A missense Het probably benign 0.051 phenotype 05/23/2014
57 198391 UTSW Etnk2 0.260 R1728 G1 159 N 1 133365765 G149W G T missense Het probably damaging 1.000 phenotype 05/23/2014
58 198392 UTSW Etnk2 0.260 R1728 G1 225 N 1 133365816 R166* C T nonsense Het probably null phenotype 05/23/2014
59 198393 UTSW Etnk2 0.260 R1728 G1 198 N 1 133365817 R166Q G A missense Het probably benign 0.081 phenotype 05/23/2014
60 198396 UTSW Etnk2 0.260 R1728 G1 178 N 1 133376915 V292E T A missense Het probably benign 0.000 phenotype 05/23/2014
61 198563 UTSW Fam187b 0.070 R1728 G1 223 N 7 30989020 Q268* C T nonsense Het probably null 05/23/2014
62 198359 UTSW Fam72a 0.205 R1728 G1 225 N 1 131530668 I56T T C missense Het probably benign 0.001 05/23/2014
63 198360 UTSW Fam72a 0.205 R1728 G1 225 N 1 131538895 T139M C T missense Het probably benign 0.001 05/23/2014
64 198576 UTSW Fat3 0.481 R1728 G1 225 N 9 15996315 V2797G A C missense Het possibly damaging 0.652 phenotype 05/23/2014
65 198343 UTSW Fcamr 0.067 R1728 G1 85 N 1 130804569 R98G A G missense Het probably benign 0.065 phenotype 05/23/2014
66 198344 UTSW Fcamr 0.067 R1728 G1 186 N 1 130804627 N117T A C missense Het probably benign 0.003 phenotype 05/23/2014
67 198346 UTSW Fcamr 0.067 R1728 G1 225 N 1 130811580 I206V A G missense Het probably benign 0.000 phenotype 05/23/2014
68 198347 UTSW Fcamr 0.067 R1728 G1 198 N 1 130812629 G262S G A missense Het probably benign 0.376 phenotype 05/23/2014
69 198348 UTSW Fcamr 0.067 R1728 G1 225 N 1 130812692 I283V A G missense Het probably benign 0.000 phenotype 05/23/2014
70 198349 UTSW Fcamr 0.067 R1728 G1 225 N 1 130812738 V298A T C missense Het probably benign 0.002 phenotype 05/23/2014
71 198350 UTSW Fcamr 0.067 R1728 G1 225 N 1 130812809 M322V A G missense Het probably benign 0.016 phenotype 05/23/2014
72 198351 UTSW Fcamr 0.067 R1728 G1 225 N 1 130812816 P324L C T missense Het probably benign 0.414 phenotype 05/23/2014
73 198352 UTSW Fcamr 0.067 R1728 G1 225 N 1 130814597 N574D A G missense Het probably benign 0.000 phenotype 05/23/2014
74 198354 UTSW Fcmr 0.000 R1728 G1 225 N 1 130875974 T172A A G missense Het probably benign 0.000 phenotype 05/23/2014
75 198355 UTSW Fcmr 0.000 R1728 G1 173 N 1 130878269 S321P T C missense Het probably benign 0.001 phenotype 05/23/2014
76 198570 UTSW Fut10 0.163 R1728 G1 225 N 8 31201390 S88T T A missense Het probably benign 0.002 05/23/2014
77 198593 UTSW Gabarap 0.000 R1728 G1 119 N 11 69991689 C T unclassified Het probably benign phenotype 05/23/2014
78 198313 UTSW Gli2 1.000 R1728 G1 167 N 1 118868087 A113T C T missense Het possibly damaging 0.679 phenotype 05/23/2014
79 198315 UTSW Gli2 1.000 R1728 G1 225 N 1 119002044 H44Q G T missense Het probably benign 0.001 phenotype 05/23/2014
80 198528 UTSW Glrx2 0.211 R1728 G1 111 N 1 143739740 A27V C T missense Het possibly damaging 0.904 phenotype 05/23/2014
81 198379 UTSW Gm28040 0.125 R1728 G1 145 N 1 133327321 AGTG AGTGGCACCTTTGGTG small insertion Het probably benign 05/23/2014
82 198571 UTSW Gm5346 0.085 R1728 G1 225 N 8 43625583 N535D T C missense Het probably damaging 0.999 05/23/2014
83 198494 UTSW Gpr25 0.309 R1728 G1 89 N 1 136260710 P55L G A missense Het probably benign 0.000 phenotype 05/23/2014
84 198575 UTSW Gse1 0.239 R1728 G1 207 N 8 120568253 G A intron Het probably benign 05/23/2014
85 198602 UTSW Heatr4 0.083 R1728 G1 189 N 12 83967572 I630M T C missense Het probably benign 0.029 05/23/2014
86 198554 UTSW Hectd4 0.393 R1728 G1 225 N 5 121301839 Y1134F A T missense Het possibly damaging 0.514 05/23/2014
87 198471 UTSW Igfn1 0.195 R1728 G1 225 N 1 135959928 P2466L G A missense Het probably damaging 1.000 05/23/2014
88 198472 UTSW Igfn1 0.195 R1728 G1 225 N 1 135968199 A1543V G A missense Het probably benign 0.000 05/23/2014
89 198473 UTSW Igfn1 0.195 R1728 G1 225 N 1 135970411 S806G T C missense Het probably benign 0.000 05/23/2014
90 198474 UTSW Igfn1 0.195 R1728 G1 221 N 1 135972127 R482Q C T missense Het probably benign 0.000 05/23/2014
91 198476 UTSW Igfn1 0.195 R1728 G1 224 N 1 135979915 A231T C T missense Het probably benign 0.002 05/23/2014
92 198477 UTSW Igfn1 0.195 R1728 G1 225 N 1 135982475 R124W G A missense Het probably benign 0.000 05/23/2014
93 198478 UTSW Igfn1 0.195 R1728 G1 225 N 1 135998625 E29G T C missense Het probably benign 0.000 05/23/2014
94 198479 UTSW Igfn1 0.195 R1728 G1 199 N 1 135998683 I10V T C missense Het unknown 05/23/2014
95 198357 UTSW Ikbke 0.000 R1728 G1 225 N 1 131265937 A459S C A missense Het probably benign 0.012 phenotype 05/23/2014
96 198358 UTSW Ikbke 0.000 R1728 G1 225 N 1 131269823 S447G T C missense Het probably benign 0.003 phenotype 05/23/2014
97 198618 UTSW Ildr1 0.139 R1728 G1 225 N 16 36708336 T48S A T missense Het possibly damaging 0.800 phenotype 05/23/2014
98 198440 UTSW Ipo9 1.000 R1728 G1 217 N 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 05/23/2014
99 198441 UTSW Ipo9 1.000 R1728 G1 160 N 1 135386271 CTC CTCTTC small insertion Het probably benign phenotype 05/23/2014
100 198445 UTSW Ipo9 1.000 R1728 G1 225 N 1 135402250 V484A A G missense Het probably benign 0.000 0.116 phenotype 05/23/2014
[records 1 to 100 of 224] next >> last >|