Incidental Mutations

80 incidental mutations are currently displayed, and affect 80 genes.
11 are Possibly Damaging.
26 are Probably Damaging.
32 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 204929 UTSW 1700003H04Rik 0.013 R1833 G1 225 Y 3 124556860 D143V T A missense Het unknown 0.042 06/23/2014
2 204973 UTSW 4930438A08Rik 0.229 R1833 G1 225 Y 11 58288388 Q183* C T nonsense Het probably null 0.622 06/23/2014
3 204972 UTSW 9230009I02Rik 0.167 R1833 G1 225 Y 11 51091466 A G exon Het noncoding transcript 0.052 06/23/2014
4 204923 UTSW Abhd12 0.443 R1833 G1 225 Y 2 150848418 D119V T A missense Het probably damaging 0.968 0.372 phenotype 06/23/2014
5 204939 UTSW Adam1b 0.000 R1833 G1 225 Y 5 121502937 I15T A G missense Het possibly damaging 0.670 0.062 phenotype 06/23/2014
6 204985 UTSW Agtpbp1 0.651 R1833 G1 225 Y 13 59465983 A T critical splice donor site 2 bp Het probably null 0.480 phenotype 06/23/2014
7 204909 UTSW Arfgef1 1.000 R1833 G1 225 Y 1 10204890 I312M G C missense Het probably benign 0.008 0.061 phenotype 06/23/2014
8 204979 UTSW Arid4a 0.000 R1833 G1 225 Y 12 71075466 L874F C T missense Het possibly damaging 0.499 0.067 phenotype 06/23/2014
9 204977 UTSW Bcas3 0.507 R1833 G1 225 Y 11 85583949 V317I G A missense Het probably benign 0.003 0.072 06/23/2014
10 204970 UTSW Ccr1 0.162 R1833 G1 225 Y 9 123964089 I135F T A missense Het probably damaging 0.998 0.278 phenotype 06/23/2014
11 204961 UTSW Ces2h 0.170 R1833 G1 225 Y 8 105020373 E547G A G missense Het possibly damaging 0.927 0.276 phenotype 06/23/2014
12 204962 UTSW Ces3b 0.013 R1833 G1 225 Y 8 105085639 D173E T A missense Het probably damaging 0.983 0.196 06/23/2014
13 204974 UTSW Chd3 0.444 R1833 G1 225 Y 11 69354123 L1197S A G missense Het probably damaging 0.995 0.082 phenotype 06/23/2014
14 204960 UTSW Cngb1 1.000 R1833 G1 225 Y 8 95242355 L1175P A G missense Het probably damaging 0.998 0.186 phenotype 06/23/2014
15 204992 UTSW Cyp4f17 0.073 R1833 G1 225 Y 17 32524210 F286L T C missense Het probably benign 0.012 0.141 06/23/2014
16 205000 UTSW Dclre1a 0.000 R1833 G1 193 Y 19 56541500 C T splice site 5 bp Het probably null 0.650 phenotype 06/23/2014
17 204987 UTSW Dennd6a 0.216 R1833 G1 225 Y 14 26606954 L44H T A missense Het probably damaging 0.999 0.025 06/23/2014
18 204994 UTSW Dhx16 0.917 R1833 G1 225 Y 17 35885619 T560A A G missense Het probably benign 0.361 0.122 phenotype 06/23/2014
19 204916 UTSW Dusp12 0.173 R1833 G1 225 Y 1 170874453 M326V T C missense Het probably benign 0.000 0.220 phenotype 06/23/2014
20 204954 UTSW Eif3k 0.903 R1833 G1 225 Y 7 28971427 I180V T C missense Het probably benign 0.028 0.164 phenotype 06/23/2014
21 204946 UTSW Erc1 1.000 R1833 G1 225 Y 6 119743429 I437T A G missense Het possibly damaging 0.815 0.022 phenotype 06/23/2014
22 204980 UTSW Fam71d 0.069 R1833 G1 225 Y 12 78715506 G A unclassified Het probably benign 0.105 06/23/2014
23 204913 UTSW Farp2 0.000 R1833 G1 225 Y 1 93576364 T A splice site Het probably benign 0.116 phenotype 06/23/2014
24 204952 UTSW Foxa3 0.000 R1833 G1 225 Y 7 19014574 L209P A G missense Het probably damaging 0.999 0.770 phenotype 06/23/2014
25 204978 UTSW Gen1 0.232 R1833 G1 225 Y 12 11248351 A T splice site Het probably benign 0.060 phenotype 06/23/2014
26 204933 UTSW Gm10305 0.256 R1833 G1 205 Y 4 99273126 T91A A G missense Het unknown 0.070 06/23/2014
27 204982 UTSW Gm10436 0.232 R1833 G1 225 Y 12 88178448 E44G T C missense Het possibly damaging 0.727 0.096 06/23/2014
28 204925 UTSW Gm14412 0.412 R1833 G1 99 Y 2 177315790 D104G T C missense Het probably benign 0.002 0.145 06/23/2014
29 204999 UTSW Gm340 0.129 R1833 G1 225 Y 19 41584948 I714T T C missense Het probably benign 0.001 0.151 06/23/2014
30 204950 UTSW Gm6900 0.394 R1833 G1 225 Y 7 10656588 T C exon Het noncoding transcript 06/23/2014
31 204968 UTSW Gpx1 0.000 R1833 G1 126 Y 9 108339356 Y15F A T missense Het possibly damaging 0.888 0.056 phenotype 06/23/2014
32 204995 UTSW H2-M10.3 0.114 R1833 G1 225 Y 17 36367495 Y146C T C missense Het probably damaging 1.000 0.472 06/23/2014
33 204993 UTSW H2-Q7 0.132 R1833 G1 120 Y 17 35439699 S104R C A missense Het probably benign 0.005 0.053 phenotype 06/23/2014
34 204964 UTSW Hephl1 0.132 R1833 G1 225 Y 9 15076928 Y628C T C missense Het probably damaging 0.994 0.432 06/23/2014
35 204918 UTSW Hspa5 1.000 R1833 G1 225 Y 2 34776053 Y636* T A nonsense Het probably null 0.600 phenotype 06/23/2014
36 204936 UTSW Htt 1.000 R1833 G1 183 Y 5 34905748 A G splice site Het probably benign 0.060 phenotype 06/23/2014
37 204912 UTSW Idh1 0.000 R1833 G1 225 Y 1 65161114 I364V T C missense Het probably benign 0.000 0.078 phenotype 06/23/2014
38 204975 UTSW Itgae 0.000 R1833 G1 225 Y 11 73117162 A423S G T missense Het possibly damaging 0.944 0.250 phenotype 06/23/2014
39 204990 UTSW Kng2 0.189 R1833 G1 225 Y 16 23012052 N169S T C missense Het possibly damaging 0.948 0.124 06/23/2014
40 204983 UTSW Larp4b 0.446 R1833 G1 225 Y 13 9151199 T369I C T missense Het possibly damaging 0.895 0.060 phenotype 06/23/2014
41 204910 UTSW Lonrf2 0.166 R1833 G1 225 Y 1 38813276 P165S G A missense Het probably benign 0.140 0.026 06/23/2014
42 204935 UTSW Magi2 1.000 R1833 G1 225 Y 5 19227457 G57C G T missense Het probably damaging 1.000 0.210 phenotype 06/23/2014
43 204932 UTSW Mdn1 0.969 R1833 G1 225 Y 4 32720761 H2291Q T A missense Het probably damaging 0.968 0.184 06/23/2014
44 204943 UTSW Mgam 0.258 R1833 G1 225 Y 6 40654718 T C critical splice donor site 2 bp Het probably null 0.532 phenotype 06/23/2014
45 204940 UTSW Micall2 0.283 R1833 G1 225 Y 5 139716753 V245A A G missense Het probably benign 0.087 0.144 06/23/2014
46 204988 UTSW Mipep 0.957 R1833 G1 225 Y 14 60872063 Y630D T G missense Het probably damaging 1.000 0.346 phenotype 06/23/2014
47 204984 UTSW Msx2 0.000 R1833 G1 225 Y 13 53468185 M263K A T missense Het probably damaging 0.987 0.268 phenotype 06/23/2014
48 204953 UTSW Nectin2 0.300 R1833 G1 225 Y 7 19717708 P467H G T missense Het probably damaging 0.960 0.034 phenotype 06/23/2014
49 204986 UTSW Nek10 0.203 R1833 G1 225 Y 14 14842789 M165L A T missense Het probably benign 0.000 0.052 06/23/2014
50 204951 UTSW Nlrp4b 0.052 R1833 G1 225 Y 7 10725936 M455L A T missense Het probably benign 0.001 0.120 06/23/2014
51 204927 UTSW Oaz3 0.226 R1833 G1 192 Y 3 94436042 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG unclassified Het probably benign phenotype 06/23/2014
52 204921 UTSW Olfr1258 0.071 R1833 G1 225 Y 2 89930301 L164* T A nonsense Het probably null 0.659 phenotype 06/23/2014
53 204989 UTSW Olfr286 0.100 R1833 G1 225 Y 15 98226965 I227F T A missense Het probably damaging 0.998 0.029 phenotype 06/23/2014
54 204997 UTSW Pcx 0.576 R1833 G1 225 Y 19 4619104 V710E T A missense Het probably damaging 0.982 0.242 phenotype 06/23/2014
55 204930 UTSW Pkn2 1.000 R1833 G1 225 Y 3 142821647 R347Q C T missense Het probably damaging 1.000 0.352 phenotype 06/23/2014
56 204914 UTSW Qsox1 0.499 R1833 G1 225 Y 1 155791045 G233S C T missense Het probably benign 0.147 0.184 phenotype 06/23/2014
57 204924 UTSW Rbl1 0.000 R1833 G1 225 Y 2 157195555 N224I T A missense Het probably damaging 0.976 0.410 phenotype 06/23/2014
58 204959 UTSW Rspry1 0.249 R1833 G1 225 Y 8 94635488 T132A A G missense Het probably damaging 1.000 0.030 phenotype 06/23/2014
59 204926 UTSW Sclt1 0.356 R1833 G1 225 Y 3 41727111 V91A A G missense Het probably damaging 0.992 0.230 phenotype 06/23/2014
60 204945 UTSW Sema4f 0.000 R1833 G1 225 Y 6 82918559 L331H A T missense Het probably benign 0.017 0.056 phenotype 06/23/2014
61 204963 UTSW Sf3b3 0.974 R1833 G1 225 Y 8 110817566 Q814L T A missense Het probably benign 0.000 0.136 phenotype 06/23/2014
62 204915 UTSW Slc19a2 0.153 R1833 G1 225 Y 1 164262184 Y190D T G missense Het probably damaging 1.000 0.398 phenotype 06/23/2014
63 204969 UTSW Smarcc1 1.000 R1833 G1 225 Y 9 110153811 H204Q T A missense Het possibly damaging 0.711 0.056 phenotype 06/23/2014
64 204957 UTSW Sox6 1.000 R1833 G1 225 Y 7 115777093 K135E T C missense Het probably damaging 1.000 0.206 phenotype 06/23/2014
65 204941 UTSW Tecpr1 0.000 R1833 G1 159 Y 5 144208608 Q607R T C missense Het probably damaging 0.989 0.166 phenotype 06/23/2014
66 204958 UTSW Tgfb1i1 0.319 R1833 G1 207 Y 7 128249498 A G splice site Het probably benign phenotype 06/23/2014
67 204965 UTSW Tirap 0.228 R1833 G1 225 Y 9 35188703 R228S T G missense Het probably benign 0.185 0.053 phenotype 06/23/2014
68 204938 UTSW Tmem211 0.090 R1833 G1 172 Y 5 113234569 A G splice site Het probably benign 06/23/2014
69 204917 UTSW Trp53bp2 1.000 R1833 G1 225 Y 1 182429016 H50Q T A missense Het probably damaging 0.983 0.148 phenotype 06/23/2014
70 204944 UTSW Try4 0.082 R1833 G1 225 Y 6 41303431 H63R A G missense Het probably damaging 0.982 0.498 06/23/2014
71 204947 UTSW Vmn2r25 0.132 R1833 G1 225 Y 6 123839684 P313S G A missense Het probably benign 0.015 0.125 06/23/2014
72 204971 UTSW Vps26a 0.272 R1833 G1 225 Y 10 62459046 L250V A C missense Het probably benign 0.003 0.126 phenotype 06/23/2014
73 204948 UTSW Vwf 0.243 R1833 G1 225 Y 6 125642037 H1226R A G missense Het probably benign 0.142 0.200 phenotype 06/23/2014
74 204934 UTSW Wdtc1 0.801 R1833 G1 195 Y 4 133308742 TCC TC splice site Het probably benign 0.140 phenotype 06/23/2014
75 204942 UTSW Zc3hav1l 0.152 R1833 G1 225 Y 6 38297946 A T splice site Het probably benign 0.125 06/23/2014
76 204996 UTSW Zfp119b 0.104 R1833 G1 225 Y 17 55939271 H305P T G missense Het probably damaging 1.000 0.071 06/23/2014
77 204937 UTSW Zfp326 0.314 R1833 G1 225 Y 5 105891169 Q134* C T nonsense Het probably null 0.572 06/23/2014
78 204956 UTSW Zfp975 0.094 R1833 G1 225 Y 7 42661839 R450Q C T missense Het probably benign 0.006 0.123 06/23/2014
79 204981 UTSW Zfyve26 0.646 R1833 G1 120 Y 12 79286258 M313K A T missense Het probably benign 0.358 0.062 phenotype 06/23/2014
80 204949 UTSW Zscan5b 0.070 R1833 G1 225 Y 7 6238966 S395P T C missense Het possibly damaging 0.669 0.058 06/23/2014
[records 1 to 80 of 80]