Incidental Mutations

52 incidental mutations are currently displayed, and affect 50 genes.
7 are Possibly Damaging.
22 are Probably Damaging.
14 are Probably Benign.
8 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 274980 UTSW Adat1 0.092 R3807 G1 225 N 8 111990370 W2R A T missense Het probably damaging 1.000 phenotype 04/02/2015
2 274982 UTSW Arhgap42 0.906 R3807 G1 225 N 9 9008033 I563T A G missense Het probably damaging 0.979 phenotype 04/02/2015
3 275008 UTSW Armcx1 R3807 G1 222 N X 134721265 V372A T C missense Het probably damaging 0.972 phenotype 04/02/2015
4 274967 UTSW Bicd1 0.000 R3807 G1 225 N 6 149518991 L780M T A missense Het probably damaging 1.000 0.030 phenotype 04/02/2015
5 274958 UTSW Bpifb1 0.000 R3807 G1 225 N 2 154214002 N329K C A missense Het probably benign 0.254 phenotype 04/02/2015
6 274979 UTSW Ccdc113 0.060 R3807 G1 225 N 8 95542653 N193I A T missense Het probably damaging 1.000 04/02/2015
7 274998 UTSW Cebpz 0.967 R3807 G1 225 N 17 78935418 L269Q A T missense Het probably damaging 1.000 phenotype 04/02/2015
8 274976 UTSW Cttn 0.257 R3807 G1 225 N 7 144445851 V290M C T missense Het probably damaging 0.999 phenotype 04/02/2015
9 274970 UTSW Ctu1 0.879 R3807 G1 225 N 7 43676673 L252P T C missense Het probably damaging 0.999 0.382 04/02/2015
10 274975 UTSW Dmbt1 0.206 R3807 G1 225 N 7 131112090 M1455K T A missense Het possibly damaging 0.770 phenotype 04/02/2015
11 274986 UTSW Eme1 0.000 R3807 G1 225 N 11 94650592 W135R A G missense Het probably damaging 0.997 phenotype 04/02/2015
12 275002 UTSW Entpd7 0.121 R3807 G1 225 N 19 43725540 T G critical splice donor site 2 bp Het probably null phenotype 04/02/2015
13 274974 UTSW Eri2 0.210 R3807 G1 225 N 7 119786008 C423* A T nonsense Het probably null 0.540 04/02/2015
14 274977 UTSW Erich1 0.078 R3807 G1 225 N 8 14033695 N125S T C missense Het probably benign 0.112 04/02/2015
15 274978 UTSW Fam149a 0.000 R3807 G1 225 N 8 45381610 T51S T A missense Het possibly damaging 0.909 04/02/2015
16 274985 UTSW Fam71b 0.000 R3807 G1 225 N 11 46404953 A51T G A missense Het possibly damaging 0.773 04/02/2015
17 274959 UTSW Fer1l4 0.000 R3807 G1 225 N 2 156045683 G531D C T missense Het probably damaging 1.000 04/02/2015
18 274960 UTSW Frem2 1.000 R3807 G1 225 N 3 53653449 D1212E A T missense Het probably benign 0.225 phenotype 04/02/2015
19 274965 UTSW Get4 1.000 R3807 G1 192 N 5 139252531 V23F G T missense Het probably damaging 0.983 0.388 04/02/2015
20 274987 UTSW Gm11595 0.062 R3807 G1 175 N 11 99772554 R100H C T missense Het unknown 04/02/2015
21 473943 UTSW Gria1 0.000 R3807 G1 225 N 11 57310678 W712R T C missense Het probably damaging 1.000 phenotype 04/14/2017
22 274971 UTSW Herc2 0.958 R3807 G1 225 N 7 56207809 N4047D A G missense Het probably damaging 0.998 phenotype 04/02/2015
23 274994 UTSW Hoxc9 0.000 R3807 G1 225 N 15 102981684 Y11C A G missense Het possibly damaging 0.943 phenotype 04/02/2015
24 274983 UTSW Lama2 0.335 R3807 G1 217 N 10 27190665 GCCC GCC frame shift Het probably null phenotype 04/02/2015
25 473940 UTSW Lrrc56 0.094 R3807 G1 225 N 7 141209385 T393A A G missense Het probably benign 0.000 04/14/2017
26 274963 UTSW Lrrc7 0.611 R3807 G1 225 N 3 158185493 I346V T C missense Het probably benign 0.100 0.082 phenotype 04/02/2015
27 275006 UTSW Med14 0.929 R3807 G1 222 N X 12687177 Y463C T C missense Het probably damaging 1.000 phenotype 04/02/2015
28 274993 UTSW Nalcn 1.000 R3807 G1 225 N 14 123278187 D1734V T A missense Het probably damaging 0.997 phenotype 04/02/2015
29 274966 UTSW Nfe2l3 0.000 R3807 G1 225 N 6 51457377 R306* A T nonsense Het probably null phenotype 04/02/2015
30 275003 UTSW Nolc1 0.000 R3807 G1 217 N 19 46081352 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC small insertion Het probably benign 04/02/2015
31 275004 UTSW Nolc1 0.000 R3807 G1 142 N 19 46081359 CAG CAGAAG small insertion Het probably benign 04/02/2015
32 275005 UTSW Nolc1 0.000 R3807 G1 137 N 19 46081371 CAG CAGAAG small insertion Het probably benign 04/02/2015
33 274962 UTSW Npr1 0.110 R3807 G1 225 N 3 90458726 V586E A T missense Het probably damaging 0.984 phenotype 04/02/2015
34 473944 UTSW Olfr192 0.181 R3807 G1 225 N 16 59098843 *50G A C makesense Het probably null 04/14/2017
35 274973 UTSW Olfr715b 0.124 R3807 G1 225 N 7 107106463 S133P A G missense Het probably benign 0.009 04/02/2015
36 274999 UTSW Pcdhb4 0.064 R3807 G1 225 N 18 37309314 F559S T C missense Het probably damaging 0.975 04/02/2015
37 274988 UTSW Psmd12 0.953 R3807 G1 225 N 11 107495765 D387E T G missense Het probably benign 0.029 phenotype 04/02/2015
38 274984 UTSW Psme4 0.000 R3807 G1 225 N 11 30856027 T A splice site Het probably null phenotype 04/02/2015
39 274991 UTSW Ptch1 1.000 R3807 G1 225 N 13 63524959 E944A T G missense Het probably benign 0.003 0.040 phenotype 04/02/2015
40 274997 UTSW Rgs11 0.163 R3807 G1 225 N 17 26203500 I69F A T missense Het probably damaging 0.991 phenotype 04/02/2015
41 274969 UTSW Ryr1 1.000 R3807 G1 219 N 7 29020152 A4277T C T missense Het probably damaging 1.000 phenotype 04/02/2015
42 275000 UTSW Setbp1 0.526 R3807 G1 225 N 18 78783322 V1359I C T missense Het probably benign 0.006 phenotype 04/02/2015
43 274961 UTSW Sis 0.000 R3807 G1 225 N 3 72925596 V956E A T missense Het probably benign 0.007 phenotype 04/02/2015
44 274981 UTSW Slc35f3 0.172 R3807 G1 225 N 8 126389239 W302R T A missense Het probably damaging 1.000 04/02/2015
45 274989 UTSW Syt16 0.000 R3807 G1 225 N 12 74229398 E212G A G missense Het possibly damaging 0.934 04/02/2015
46 274990 UTSW Tdp2 0.731 R3807 G1 225 N 13 24831793 S21* C A nonsense Het probably null phenotype 04/02/2015
47 274995 UTSW Tfrc 1.000 R3807 G1 225 N 16 32616826 N173I A T missense Het possibly damaging 0.466 phenotype 04/02/2015
48 274964 UTSW Tmem132b 0.113 R3807 G1 225 N 5 125787580 I917F A T missense Het probably damaging 0.999 04/02/2015
49 275007 UTSW Vbp1 R3807 G1 222 N X 75523342 V122A T C missense Het probably damaging 0.999 phenotype 04/02/2015
50 274996 UTSW Vmn1r225 0.072 R3807 G1 225 N 17 20502852 W185* G A nonsense Het probably null 04/02/2015
51 274968 UTSW Vmn1r70 0.058 R3807 G1 225 N 7 10633788 T68A A G missense Het probably benign 0.012 04/02/2015
52 275001 UTSW Zfp518a 0.891 R3807 G1 225 N 19 40914797 K1057E A G missense Het possibly damaging 0.897 phenotype 04/02/2015
[records 1 to 52 of 52]