Incidental Mutations

43 incidental mutations are currently displayed, and affect 43 genes.
9 are Possibly Damaging.
18 are Probably Damaging.
13 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 43 of 43] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 323714 UTSW Abca17 0.000 R4334 G1 225 N 17 24318268 V447E A T missense Het probably damaging 0.997 06/24/2015
2 323719 UTSW Adcyap1 0.183 R4334 G1 225 N 17 93202268 L49P T C missense Het probably benign 0.100 phenotype 06/24/2015
3 323713 UTSW B4galt4 0.259 R4334 G1 225 N 16 38752259 I102T T C missense Het probably damaging 0.986 phenotype 06/24/2015
4 323688 UTSW Cc2d2a 0.747 R4334 G1 225 N 5 43683134 D110G A G missense Het probably benign 0.003 phenotype 06/24/2015
5 323679 UTSW Ccdc141 0.000 R4334 G1 225 N 2 77170432 V19I C T missense Het probably damaging 0.998 phenotype 06/24/2015
6 323682 UTSW Ccdc39 0.634 R4334 G1 225 N 3 33837882 L147P A G missense Het probably damaging 1.000 phenotype 06/24/2015
7 323716 UTSW Cdc5l 0.962 R4334 G1 225 N 17 45410786 D519E A T missense Het probably benign 0.001 phenotype 06/24/2015
8 323704 UTSW Cdh23 0.406 R4334 G1 225 N 10 60385059 T1305K G T missense Het probably damaging 0.993 phenotype 06/24/2015
9 323684 UTSW Cfi 0.000 R4334 G1 225 N 3 129850829 V158D T A missense Het possibly damaging 0.802 phenotype 06/24/2015
10 323700 UTSW Clstn2 0.000 R4334 G1 225 N 9 97463528 Y589S T G missense Het probably damaging 1.000 phenotype 06/24/2015
11 323706 UTSW Dsp 1.000 R4334 G1 225 N 13 38196664 K1863E A G missense Het possibly damaging 0.462 phenotype 06/24/2015
12 323702 UTSW Enpp3 0.213 R4334 G1 225 N 10 24793589 M491K A T missense Het probably damaging 0.999 phenotype 06/24/2015
13 323683 UTSW Fhdc1 0.375 R4334 G1 225 N 3 84444826 V1031F C A missense Het probably benign 0.418 0.028 06/24/2015
14 323685 UTSW Fkbp15 0.000 R4334 G1 225 N 4 62303219 A1170V G A missense Het possibly damaging 0.951 06/24/2015
15 323681 UTSW Foxa2 1.000 R4334 G1 179 N 2 148044703 N64S T C missense Het possibly damaging 0.850 phenotype 06/24/2015
16 323693 UTSW Foxm1 1.000 R4334 G1 225 N 6 128365967 I88T T C missense Het probably damaging 1.000 phenotype 06/24/2015
17 323707 UTSW Gm3173 0.311 R4334 G1 176 N 14 4514779 I8L A T missense Het possibly damaging 0.598 06/24/2015
18 323687 UTSW Gpatch3 0.081 R4334 G1 225 N 4 133582481 D375G A G missense Het probably damaging 1.000 06/24/2015
19 323695 UTSW Herc2 0.958 R4334 G1 225 N 7 56226654 F4436L T C missense Het probably damaging 0.999 phenotype 06/24/2015
20 323699 UTSW Htr3b 0.000 R4334 G1 225 N 9 48945509 A223V G A missense Het probably damaging 1.000 phenotype 06/24/2015
21 323677 UTSW Iars2 1.000 R4334 G1 225 N 1 185303394 T550S T A missense Het probably benign 0.349 phenotype 06/24/2015
22 500583 UTSW Igsf9 0.000 R4334 G1 225 N 1 172494212 K149* A T nonsense Het probably null phenotype 12/01/2017
23 323708 UTSW Khnyn 0.079 R4334 G1 225 N 14 55894042 D536G A G missense Het probably damaging 1.000 phenotype 06/24/2015
24 323712 UTSW Kng1 0.000 R4334 G1 225 N 16 23079620 V409A T C missense Het possibly damaging 0.876 phenotype 06/24/2015
25 323711 UTSW Krt1 0.473 R4334 G1 106 N 15 101850378 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC small deletion Het probably benign 0.068 phenotype 06/24/2015
26 323680 UTSW Madd 1.000 R4334 G1 225 N 2 91140572 V1508I C T missense Het probably benign 0.076 phenotype 06/24/2015
27 323691 UTSW Micall2 0.198 R4334 G1 225 N 5 139713350 E527G T C missense Het probably damaging 0.996 06/24/2015
28 323720 UTSW Myo7b 0.000 R4334 G1 225 N 18 31976987 S1141P A G missense Het probably damaging 1.000 phenotype 06/24/2015
29 323676 UTSW Ncoa2 0.963 R4334 G1 225 N 1 13174963 P504S G A missense Het possibly damaging 0.766 phenotype 06/24/2015
30 323678 UTSW Notch1 1.000 R4334 G1 102 N 2 26460036 T2364I G A missense Het probably benign 0.221 phenotype 06/24/2015
31 323697 UTSW Pde4c 0.000 R4334 G1 225 N 8 70749826 T A splice site Het probably null phenotype 06/24/2015
32 323701 UTSW Pik3cb 0.957 R4334 G1 225 N 9 99061851 L633P A G missense Het probably damaging 1.000 phenotype 06/24/2015
33 323703 UTSW Ranbp2 1.000 R4334 G1 225 N 10 58463994 D483E T A missense Het probably damaging 0.999 phenotype 06/24/2015
34 323721 UTSW Sh3tc2 0.000 R4334 G1 225 N 18 61990321 N718D A G missense Het probably damaging 1.000 phenotype 06/24/2015
35 323718 UTSW Spast 0.000 R4334 G1 225 N 17 74352015 A126T G A missense Het probably damaging 1.000 phenotype 06/24/2015
36 323694 UTSW Ssc5d 0.000 R4334 G1 225 N 7 4943664 S1006P T C missense Het probably benign 0.000 06/24/2015
37 323710 UTSW Tmprss6 0.082 R4334 G1 225 N 15 78459427 T A splice site 3 bp Het probably null 0.606 phenotype 06/24/2015
38 323690 UTSW Ulk1 0.000 R4334 G1 225 N 5 110789357 R691Q C T missense Het probably benign 0.033 0.090 phenotype 06/24/2015
39 323705 UTSW Unc79 1.000 R4334 G1 225 N 12 103078974 T803M C T missense Het probably benign 0.000 phenotype 06/24/2015
40 323717 UTSW Vmn2r118 0.134 R4334 G1 225 N 17 55610347 F388L A T missense Het possibly damaging 0.585 06/24/2015
41 323696 UTSW Vmn2r71 0.104 R4334 G1 225 N 7 85619834 V415A T C missense Het probably benign 0.007 06/24/2015
42 323715 UTSW Wdr4 0.947 R4334 G1 225 N 17 31499152 F316Y A T missense Het possibly damaging 0.702 phenotype 06/24/2015
43 323698 UTSW Zfp810 0.085 R4334 G1 225 N 9 22278784 Y276C T C missense Het probably benign 0.002 06/24/2015
[records 1 to 43 of 43]