Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
12 are Possibly Damaging.
20 are Probably Damaging.
28 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 439433 UTSW 2410004B18Rik 0.321 R4931 G1 58 Y 3 145938120 D21G A G missense Het probably benign 0.001 0.123 10/28/2016
2 380542 UTSW 4930402H24Rik 0.144 R4931 G1 225 Y 2 130741873 F496L A G missense Het possibly damaging 0.580 0.042 phenotype 04/15/2016
3 380593 UTSW 4930562C15Rik 0.215 R4931 G1 176 Y 16 4861046 L68P T C missense Het possibly damaging 0.469 0.060 04/15/2016
4 380553 UTSW Ache 0.451 R4931 G1 225 Y 5 137291914 I414V A G missense Het probably benign 0.001 0.016 phenotype 04/15/2016
5 380577 UTSW Acy1 0.139 R4931 G1 146 Y 9 106433191 H308Y G A missense Het probably damaging 1.000 0.578 phenotype 04/15/2016
6 380575 UTSW AF529169 0.270 R4931 G1 225 Y 9 89601652 H564R T C missense Het probably benign 0.051 0.122 04/15/2016
7 380546 UTSW Aldh1b1 0.265 R4931 G1 225 Y 4 45803661 I400L A C missense Het probably benign 0.076 0.112 phenotype 04/15/2016
8 380580 UTSW Ankrd40 0.229 R4931 G1 225 Y 11 94334821 L226Q T A missense Het probably benign 0.415 0.202 04/15/2016
9 380567 UTSW B3gnt9 0.331 R4931 G1 205 Y 8 105254244 T171A T C missense Het probably benign 0.000 0.119 04/15/2016
10 380573 UTSW Ccdc33 0.155 R4931 G1 225 Y 9 58069851 Y289C T C missense Het probably damaging 0.997 0.126 04/15/2016
11 380565 UTSW Cd209f 0.179 R4931 G1 225 Y 8 4103688 I187N A T missense Het probably damaging 1.000 0.023 04/15/2016
12 380540 UTSW Cers6 0.215 R4931 G1 225 Y 2 69105112 S319A T G missense Het probably damaging 0.981 0.260 phenotype 04/15/2016
13 380543 UTSW Chrna4 0.196 R4931 G1 225 Y 2 181028872 S364P A G missense Het probably benign 0.003 0.070 phenotype 04/15/2016
14 380566 UTSW Chrnb3 0.101 R4931 G1 225 Y 8 27394230 S317P T C missense Het probably damaging 0.992 0.204 phenotype 04/15/2016
15 380587 UTSW Dapk1 0.310 R4931 G1 225 Y 13 60760960 V1129A T C missense Het probably benign 0.039 0.154 phenotype 04/15/2016
16 500838 UTSW Dhx9 1.000 R4931 G1 225 N 1 153472673 P302L G A missense Het probably benign 0.023 phenotype 12/01/2017
17 380595 UTSW Dnah8 0.516 R4931 G1 225 Y 17 30748568 D2585N G A missense Het probably benign 0.002 0.114 phenotype 04/15/2016
18 380541 UTSW Duox2 0.000 R4931 G1 225 Y 2 122296755 N147S T C missense Het probably benign 0.012 0.133 phenotype 04/15/2016
19 380536 UTSW Dytn 0.049 R4931 G1 225 Y 1 63633678 E522A T G missense Het probably benign 0.258 0.228 04/15/2016
20 380548 UTSW E130114P18Rik 0.141 R4931 G1 225 Y 4 97720287 D27G T C missense Het unknown 04/15/2016
21 380544 UTSW Egf 0.000 R4931 G1 225 Y 3 129711468 F118S A G missense Het probably damaging 1.000 0.400 phenotype 04/15/2016
22 380537 UTSW Eif2d 0.088 R4931 G1 225 Y 1 131154391 F73L T A missense Het probably damaging 0.997 0.410 phenotype 04/15/2016
23 380558 UTSW Eps8l1 0.000 R4931 G1 225 Y 7 4471241 E237G A G missense Het possibly damaging 0.951 0.136 phenotype 04/15/2016
24 380592 UTSW Espl1 1.000 R4931 G1 225 Y 15 102305730 E664G A G missense Het probably benign 0.018 0.124 phenotype 04/15/2016
25 380551 UTSW Fbrsl1 0.254 R4931 G1 190 Y 5 110379029 S373T A T missense Het possibly damaging 0.893 0.190 04/15/2016
26 380550 UTSW Fras1 0.000 R4931 G1 225 Y 5 96636840 F894Y T A missense Het probably benign 0.023 0.112 phenotype 04/15/2016
27 380549 UTSW Gm12800 0.096 R4931 G1 225 Y 4 101909170 V17A T C missense Het possibly damaging 0.473 0.065 04/15/2016
28 380583 UTSW Gpatch8 0.492 R4931 G1 225 Y 11 102481224 E496G T C missense Het unknown 0.166 phenotype 04/15/2016
29 380570 UTSW Gucy1a2 0.251 R4931 G1 225 Y 9 3759588 K465E A G missense Het probably damaging 0.997 0.090 phenotype 04/15/2016
30 380574 UTSW Igdcc4 0.424 R4931 G1 113 Y 9 65124015 T459A A G missense Het possibly damaging 0.657 0.098 04/15/2016
31 380563 UTSW Itgad 0.057 R4931 G1 225 Y 7 128204625 I64F A T missense Het probably damaging 1.000 0.230 phenotype 04/15/2016
32 439436 UTSW Itgb2l 0.149 R4931 G1 225 Y 16 96437449 N50I T A missense Het probably damaging 1.000 0.610 phenotype 10/28/2016
33 439435 UTSW Kif13a 0.402 R4931 G1 225 Y 13 46809055 I478T A G missense Het probably damaging 0.965 0.126 phenotype 10/28/2016
34 380581 UTSW Krt31 0.120 R4931 G1 225 Y 11 100050157 T109I G A missense Het probably benign 0.052 0.084 04/15/2016
35 380556 UTSW Ltbr 0.131 R4931 G1 225 Y 6 125307474 G T splice site Het probably null 0.642 phenotype 04/15/2016
36 380561 UTSW Magel2 0.229 R4931 G1 225 Y 7 62380624 D1092G A G missense Het unknown 0.118 phenotype 04/15/2016
37 380539 UTSW Mindy3 0.320 R4931 G1 225 Y 2 12396213 N231K A T missense Het probably damaging 1.000 0.358 phenotype 04/15/2016
38 380596 UTSW Mpnd 0.253 R4931 G1 225 Y 17 56012362 T G intron Het probably benign 04/15/2016
39 380554 UTSW Mtus2 0.208 R4931 G1 225 Y 5 148077416 L340F C T missense Het probably benign 0.093 0.128 04/15/2016
40 380555 UTSW Nanog 1.000 R4931 G1 225 Y 6 122707906 A17T G A missense Het possibly damaging 0.948 0.076 phenotype 04/15/2016
41 439434 UTSW Ndufa9 0.761 R4931 G1 225 Y 6 126836320 A181E G T missense Het probably damaging 1.000 0.023 phenotype 10/28/2016
42 380562 UTSW Olfr619 0.028 R4931 G1 225 Y 7 103604374 L240R T G missense Het probably benign 0.014 0.122 phenotype 04/15/2016
43 380571 UTSW Olfr869 0.089 R4931 G1 225 Y 9 20137562 I149F A T missense Het probably benign 0.195 0.320 phenotype 04/15/2016
44 380598 UTSW Pprc1 1.000 R4931 G1 107 N 19 46071316 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC unclassified Het probably benign 0.101 phenotype 04/15/2016
45 380545 UTSW Prkacb 0.558 R4931 G1 225 Y 3 146747977 I211V T C missense Het possibly damaging 0.911 0.088 phenotype 04/15/2016
46 380538 UTSW Ptpn14 0.412 R4931 G1 191 Y 1 189851277 L774V C G missense Het probably benign 0.000 0.120 phenotype 04/15/2016
47 380590 UTSW Rad1 0.928 R4931 G1 225 Y 15 10492762 T C intron Het probably benign phenotype 04/15/2016
48 380535 UTSW Rims1 0.390 R4931 G1 208 Y 1 22533947 P391Q G T missense Het probably benign 0.260 0.040 phenotype 04/15/2016
49 380582 UTSW Rnd2 0.203 R4931 G1 225 Y 11 101468999 L57F C T missense Het probably damaging 1.000 0.218 phenotype 04/15/2016
50 380568 UTSW Sf3b3 0.974 R4931 G1 225 Y 8 110816329 R832Q C T missense Het probably benign 0.001 0.182 phenotype 04/15/2016
51 380597 UTSW Slc12a2 0.000 R4931 G1 225 Y 18 57934963 D975G A G missense Het possibly damaging 0.479 0.158 phenotype 04/15/2016
52 380589 UTSW Slitrk6 0.228 R4931 G1 225 Y 14 110750379 L632P A G missense Het probably damaging 0.999 0.104 phenotype 04/15/2016
53 380569 UTSW Spire2 0.184 R4931 G1 225 Y 8 123368784 D542G A G missense Het possibly damaging 0.539 0.128 04/15/2016
54 380552 UTSW Sppl3 0.525 R4931 G1 225 Y 5 115082314 Q95L A T missense Het probably damaging 1.000 0.625 phenotype 04/15/2016
55 500839 UTSW Stat5b 0.000 R4931 G1 225 N 11 100784254 E710* C A nonsense Het probably null phenotype 12/01/2017
56 380586 UTSW Tcl1 0.130 R4931 G1 225 Y 12 105222613 H14N G T missense Het probably damaging 0.998 0.110 phenotype 04/15/2016
57 380584 UTSW Ten1 0.165 R4931 G1 225 Y 11 116205729 F70L T C missense Het probably benign 0.317 0.120 phenotype 04/15/2016
58 380579 UTSW Tnfrsf13b 0.201 R4931 G1 225 Y 11 61140937 T35S A T missense Het possibly damaging 0.659 0.059 phenotype 04/15/2016
59 380564 UTSW Tpcn2 0.112 R4931 G1 225 Y 7 145267309 P336L G A missense Het probably benign 0.342 0.234 phenotype 04/15/2016
60 380576 UTSW Trf 1.000 R4931 G1 204 Y 9 103228048 D22Y C A missense Het probably damaging 0.991 0.062 phenotype 04/15/2016
61 380557 UTSW Ttyh1 1.000 R4931 G1 225 Y 7 4133944 A G utr 3 prime Het probably benign phenotype 04/15/2016
62 380594 UTSW Vmn2r103 0.074 R4931 G1 225 Y 17 19811769 I602F A T missense Het probably benign 0.006 0.117 04/15/2016
63 380559 UTSW Zfp296 0.529 R4931 G1 154 Y 7 19579712 C164F G T missense Het possibly damaging 0.734 0.068 04/15/2016
64 380547 UTSW Zfp352 0.122 R4931 G1 225 Y 4 90224304 Y227C A G missense Het probably damaging 0.983 0.021 04/15/2016
65 380572 UTSW Zfp599 0.106 R4931 G1 225 Y 9 22258123 W18R A T missense Het probably damaging 0.977 0.060 04/15/2016
[records 1 to 65 of 65]