Incidental Mutations

82 incidental mutations are currently displayed, and affect 82 genes.
16 are Possibly Damaging.
30 are Probably Damaging.
26 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 82 of 82] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 537769 UTSW Adcy8 0.144 R6823 G1 225.01 N 15 64754886 T G critical splice acceptor site Het probably null phenotype 10/18/2018
2 537762 UTSW Adgrv1 0.000 R6823 G1 225.01 N 13 81557081 F1537L A G missense Het probably damaging 1.000 phenotype 10/18/2018
3 537763 UTSW Aggf1 0.615 R6823 G1 225.01 N 13 95364723 S384G T C missense Het probably benign 0.112 phenotype 10/18/2018
4 537766 UTSW Anxa8 0.083 R6823 G1 225.01 N 14 34094765 D204V A T missense Het possibly damaging 0.878 phenotype 10/18/2018
5 537717 UTSW Asap3 0.166 R6823 G1 225.01 N 4 136227572 E71V A T missense Het possibly damaging 0.950 phenotype 10/18/2018
6 537771 UTSW BC024139 0.060 R6823 G1 225.01 N 15 76119746 *773W T C makesense Het probably null 10/18/2018
7 537743 UTSW Bckdhb 1.000 R6823 G1 225.01 N 9 83953761 V106A T C missense Het possibly damaging 0.761 phenotype 10/18/2018
8 537710 UTSW Cep250 0.720 R6823 G1 225.01 N 2 155981459 D1010G A G missense Het probably benign 0.021 phenotype 10/18/2018
9 537773 UTSW Chrd 1.000 R6823 G1 225.01 N 16 20734736 L243Q T A missense Het probably damaging 1.000 phenotype 10/18/2018
10 537742 UTSW Cib2 0.081 R6823 G1 225.01 N 9 54549891 L30I G T missense Het possibly damaging 0.894 phenotype 10/18/2018
11 537782 UTSW Cpsf7 0.575 R6823 G1 225.01 N 19 10532884 L113* T A nonsense Het probably null phenotype 10/18/2018
12 537708 UTSW Cubn 1.000 R6823 G1 225.01 N 2 13445029 I895L T A missense Het probably benign 0.206 phenotype 10/18/2018
13 537711 UTSW Cyp24a1 0.184 R6823 G1 225.01 N 2 170487979 R351I C A missense Het probably benign 0.117 phenotype 10/18/2018
14 537727 UTSW Cyp2a12 0.025 R6823 G1 225.01 N 7 27034156 D320V A T missense Het possibly damaging 0.774 10/18/2018
15 537760 UTSW Dact1 1.000 R6823 G1 225.01 N 12 71317939 P498R C G missense Het probably benign 0.098 phenotype 10/18/2018
16 537778 UTSW Diaph1 0.000 R6823 G1 225.01 N 18 37876383 T A intron 13315 bp Het probably null phenotype 10/18/2018
17 537704 UTSW Dnah7a 0.285 R6823 G1 225.01 N 1 53456704 I3198N A T missense Het probably benign 0.000 10/18/2018
18 537774 UTSW Dopey2 0.346 R6823 G1 225.01 N 16 93755485 I271F A T missense Het possibly damaging 0.754 10/18/2018
19 537715 UTSW Erich3 0.217 R6823 G1 225.01 N 3 154727437 F349L C A missense Het probably damaging 1.000 10/18/2018
20 537729 UTSW Fam187b 0.070 R6823 G1 225.01 N 7 30989290 V358L G C missense Het probably benign 0.014 10/18/2018
21 537712 UTSW Fat4 1.000 R6823 G1 225.01 N 3 38983939 H3913Q T A missense Het probably benign 0.055 phenotype 10/18/2018
22 537713 UTSW Fbxw7 1.000 R6823 G1 225.01 N 3 84958627 E118D G C missense Het probably benign 0.326 phenotype 10/18/2018
23 537779 UTSW Fgf1 0.000 R6823 G1 225.01 N 18 38847108 I71T A G missense Het probably damaging 0.998 phenotype 10/18/2018
24 537720 UTSW Fryl 0.878 R6823 G1 225.01 N 5 73065217 I2007K A T missense Het probably damaging 0.988 phenotype 10/18/2018
25 537740 UTSW Galnt2 0.224 R6823 G1 225.01 N 8 124324011 P130A C G missense Het probably benign 0.000 phenotype 10/18/2018
26 537724 UTSW H1fx 0.228 R6823 G1 225.01 N 6 87981302 R19C G A missense Het probably damaging 0.988 phenotype 10/18/2018
27 537750 UTSW Hmga2 0.480 R6823 G1 225.01 N 10 120476024 S14A A C missense Het possibly damaging 0.875 phenotype 10/18/2018
28 537758 UTSW Hoxb4 0.719 R6823 G1 221.01 N 11 96318654 C T unclassified Het probably benign phenotype 10/18/2018
29 537767 UTSW Hr 0.000 R6823 G1 225.01 N 14 70565374 I756F A T missense Het probably damaging 0.981 phenotype 10/18/2018
30 537781 UTSW Hrasls5 0.047 R6823 G1 225.01 N 19 7639496 A T unclassified Het probably benign 10/18/2018
31 537776 UTSW Hspa1b 0.278 R6823 G1 225.01 N 17 34958185 S275T A T missense Het probably benign 0.017 phenotype 10/18/2018
32 537716 UTSW Ikbkap 1.000 R6823 G1 225.01 N 4 56787939 Y331H A G missense Het probably damaging 1.000 phenotype 10/18/2018
33 537707 UTSW Kcnh1 0.112 R6823 G1 225.01 N 1 192505289 *99R T C makesense Het probably null phenotype 10/18/2018
34 537721 UTSW Kit 0.871 R6823 G1 225.01 N 5 75652649 L864I C A missense Het probably benign 0.008 phenotype 10/18/2018
35 537731 UTSW Klk14 0.167 R6823 G1 225.01 N 7 43694456 K196* A T nonsense Het probably null phenotype 10/18/2018
36 537705 UTSW Lmod1 0.200 R6823 G1 225.01 N 1 135325167 N53S A G missense Het probably damaging 0.979 phenotype 10/18/2018
37 537754 UTSW Myh13 0.339 R6823 G1 225.01 N 11 67356158 M1235T T C missense Het probably benign 0.000 10/18/2018
38 537703 UTSW Neurl3 0.038 R6823 G1 225.01 N 1 36268704 K175* T A nonsense Het probably null 10/18/2018
39 537755 UTSW Nlgn2 0.000 R6823 G1 225.01 N 11 69825924 K597M T A missense Het probably damaging 1.000 phenotype 10/18/2018
40 537709 UTSW Npdc1 0.000 R6823 G1 225.01 N 2 25409109 M306T T C missense Het probably damaging 0.999 phenotype 10/18/2018
41 537753 UTSW Obscn 0.731 R6823 G1 225.01 N 11 59067943 C T critical splice donor site 1 bp Het probably null phenotype 10/18/2018
42 537756 UTSW Olfr404-ps1 R6823 G1 155.01 N 11 74239696 L44P T C missense Het probably damaging 1.000 10/18/2018
43 537732 UTSW Olfr553 0.191 R6823 G1 225.01 N 7 102614486 L168F G A missense Het probably damaging 0.989 phenotype 10/18/2018
44 537741 UTSW Olfr913 0.040 R6823 G1 225.01 N 9 38594905 I228T T C missense Het possibly damaging 0.893 phenotype 10/18/2018
45 537765 UTSW Pbrm1 1.000 R6823 G1 225.01 N 14 31084790 Y1042F A T missense Het probably damaging 1.000 phenotype 10/18/2018
46 537718 UTSW Pclo 0.000 R6823 G1 225.01 N 5 14677907 T A unclassified Het probably benign phenotype 10/18/2018
47 540726 UTSW Peg10 1.000 R6823 G1 204.47 N 6 4756431 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC Het phenotype 11/16/2018
48 537757 UTSW Phf12 0.643 R6823 G1 225.01 N 11 78022511 Q430* C T nonsense Het probably null 10/18/2018
49 537728 UTSW Pld3 0.057 R6823 G1 225.01 N 7 27535897 R302H C T missense Het probably damaging 1.000 phenotype 10/18/2018
50 537725 UTSW Plekha5 0.277 R6823 G1 225.01 N 6 140525858 S112P T C missense Het probably benign 0.158 10/18/2018
51 537737 UTSW Pmfbp1 0.138 R6823 G1 225.01 N 8 109530307 S548T T A missense Het possibly damaging 0.922 10/18/2018
52 537746 UTSW Ppa1 1.000 R6823 G1 225.01 N 10 61667603 I220F A T missense Het probably damaging 0.998 phenotype 10/18/2018
53 537745 UTSW Ppp2r3d 0.499 R6823 G1 225.01 N 9 124439078 A G unclassified Het probably benign 10/18/2018
54 537780 UTSW Psmg2 0.912 R6823 G1 225.01 N 18 67648857 E164D A T missense Het possibly damaging 0.633 10/18/2018
55 537764 UTSW Rarb 0.000 R6823 G1 225.01 N 14 16443824 R155G T C missense Het probably damaging 0.998 phenotype 10/18/2018
56 537751 UTSW Rnf215 0.104 R6823 G1 225.01 N 11 4136609 L162S T C missense Het probably damaging 1.000 10/18/2018
57 540727 UTSW Rsf1 0.559 R6823 G1 217.47 N 7 97579906 GGCG GGCGACGGCCGCG unclassified Het probably benign phenotype 11/16/2018
58 537747 UTSW Rtkn2 0.227 R6823 G1 225.01 N 10 68026632 V330M G A missense Het probably damaging 0.960 10/18/2018
59 537714 UTSW Slc16a4 0.217 R6823 G1 225.01 N 3 107311498 I472F A T missense Het probably benign 0.023 10/18/2018
60 537744 UTSW Snx14 1.000 R6823 G1 225.01 N 9 88394382 N617D T C missense Het possibly damaging 0.903 phenotype 10/18/2018
61 537739 UTSW Spire2 0.138 R6823 G1 225.01 N 8 123356727 V150A T C missense Het probably damaging 1.000 10/18/2018
62 537752 UTSW Sptbn1 1.000 R6823 G1 225.01 N 11 30114787 R1904M C A missense Het probably damaging 1.000 phenotype 10/18/2018
63 537733 UTSW Swap70 0.357 R6823 G1 225.01 N 7 110281303 E575G A G missense Het possibly damaging 0.750 phenotype 10/18/2018
64 537723 UTSW Tbxas1 0.047 R6823 G1 225.01 N 6 38919153 M1L A T start codon destroyed Het possibly damaging 0.945 phenotype 10/18/2018
65 537735 UTSW Tenm3 0.312 R6823 G1 225.01 N 8 48256837 V1688D A T missense Het probably damaging 0.988 phenotype 10/18/2018
66 537722 UTSW Tgfbr3 1.000 R6823 G1 225.01 N 5 107149914 S207T A T missense Het probably damaging 0.998 phenotype 10/18/2018
67 537734 UTSW Timm44 0.975 R6823 G1 225.01 N 8 4267282 F248L A G missense Het probably damaging 1.000 phenotype 10/18/2018
68 537736 UTSW Tmem161a 0.174 R6823 G1 225.01 N 8 70181199 L170P T C missense Het probably damaging 1.000 10/18/2018
69 537706 UTSW Tmem63a 0.173 R6823 G1 225.01 N 1 180960470 Y263F A T missense Het possibly damaging 0.600 10/18/2018
70 537777 UTSW Tnfsf9 0.183 R6823 G1 225.01 N 17 57105513 L28I C A missense Het probably benign 0.002 phenotype 10/18/2018
71 537749 UTSW Tph2 0.332 R6823 G1 225.01 N 10 115174106 N183I T A missense Het probably benign 0.024 phenotype 10/18/2018
72 537726 UTSW Ttyh1 1.000 R6823 G1 225.01 N 7 4122529 I60T T C missense Het probably damaging 0.972 phenotype 10/18/2018
73 537772 UTSW Ubn1 0.614 R6823 G1 225.01 N 16 5064547 S48A T G missense Het probably damaging 0.998 phenotype 10/18/2018
74 537768 UTSW Ubr5 1.000 R6823 G1 225.01 N 15 37989598 N2019S T C missense Het probably benign 0.075 phenotype 10/18/2018
75 537759 UTSW Wbp2 0.417 R6823 G1 225.01 N 11 116086910 N6D T C missense Het probably benign 0.408 phenotype 10/18/2018
76 537738 UTSW Wdr59 0.950 R6823 G1 225.01 N 8 111459040 E810V T A missense Het possibly damaging 0.951 10/18/2018
77 537775 UTSW Wiz 1.000 R6823 G1 225.01 N 17 32360421 D220G T C missense Het probably damaging 0.991 phenotype 10/18/2018
78 537719 UTSW Yipf7 0.055 R6823 G1 225.01 N 5 69517070 L244P A G missense Het probably damaging 0.999 10/18/2018
79 537748 UTSW Zdhhc17 0.000 R6823 G1 225.01 N 10 110955111 T366A T C missense Het possibly damaging 0.907 phenotype 10/18/2018
80 537761 UTSW Zfp169 0.115 R6823 G1 225.01 N 13 48490996 A T unclassified Het probably benign phenotype 10/18/2018
81 537770 UTSW Zfp707 0.138 R6823 G1 225.01 N 15 75969723 C T unclassified Het probably benign 10/18/2018
82 537730 UTSW Zfp788 0.055 R6823 G1 225.01 N 7 41649560 H540R A G missense Het probably damaging 0.998 0.502 10/18/2018
[records 1 to 82 of 82]