Incidental Mutations

52 incidental mutations are currently displayed, and affect 51 genes.
6 are Possibly Damaging.
19 are Probably Damaging.
14 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 561896 UTSW Abca6 0.000 R7222 G1 225.01 Y 11 110191693 N1151K A T missense Het probably benign 0.294 0.130 phenotype 06/26/2019
2 561909 UTSW Add3 0.000 R7222 G1 225.01 Y 19 53216846 V9A T C missense Het unknown 0.222 phenotype 06/26/2019
3 561860 UTSW Ankar 0.057 R7222 G1 225.01 Y 1 72666355 I832T A G missense Het probably damaging 0.987 06/26/2019
4 561868 UTSW Arhgef10l 0.118 R7222 G1 225.01 Y 4 140521269 W785L C A missense Het probably damaging 1.000 phenotype 06/26/2019
5 561885 UTSW Atp7b 0.850 R7222 G1 225.01 Y 8 22022378 Q490* G A nonsense Het probably null 0.616 phenotype 06/26/2019
6 561889 UTSW Chrna5 0.159 R7222 G1 225.01 Y 9 54998063 D53G A G missense Het probably benign 0.112 phenotype 06/26/2019
7 561875 UTSW Clip1 0.000 R7222 G1 225.01 Y 5 123611841 N993I T A missense Het probably damaging 0.988 0.330 phenotype 06/26/2019
8 561877 UTSW Cyp3a59 1.000 R7222 G1 225.01 Y 5 146096575 A T critical splice acceptor site Het probably null 06/26/2019
9 561882 UTSW Dnah3 0.108 R7222 G1 225.01 Y 7 120071523 N651Y T A missense Het probably benign 0.002 phenotype 06/26/2019
10 561891 UTSW Dopey1 0.168 R7222 G1 225.01 Y 9 86522876 T C critical splice donor site 2 bp Het probably null 06/26/2019
11 561904 UTSW Eva1c 0.071 R7222 G1 217.47 Y 16 90904184 AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG small deletion Het probably benign 0.147 phenotype 06/26/2019
12 561865 UTSW Flg 0.584 R7222 G1 225.01 N 3 93288314 S74T T A missense Het unknown phenotype 06/26/2019
13 561871 UTSW Fras1 0.000 R7222 G1 225.01 Y 5 96636186 Y850H T C missense Het probably damaging 0.996 phenotype 06/26/2019
14 561872 UTSW Fras1 0.000 R7222 G1 225.01 Y 5 96636809 T884S A T missense Het probably benign 0.001 phenotype 06/26/2019
15 561862 UTSW Fsip2 0.137 R7222 G1 225.01 Y 2 82983671 T3445A A G missense Het probably benign 0.000 0.142 phenotype 06/26/2019
16 561870 UTSW Gm5861 0.226 R7222 G1 159.01 N 5 11183113 N14K T A missense Het probably damaging 0.959 06/26/2019
17 561905 UTSW Gm9992 0.096 R7222 G1 158.01 N 17 7376467 S148P A G missense Het probably damaging 1.000 06/26/2019
18 561890 UTSW Herc1 0.000 R7222 G1 225.01 Y 9 66467499 P3237H C A missense Het probably damaging 0.977 phenotype 06/26/2019
19 561895 UTSW Ifi35 0.195 R7222 G1 225.01 Y 11 101457515 N123S A G missense Het probably benign 0.002 06/26/2019
20 561878 UTSW Igkv1-117 R7222 G1 225.01 Y 6 68121749 D94V A T missense Het probably damaging 0.997 06/26/2019
21 561869 UTSW Kif1b 1.000 R7222 G1 225.01 Y 4 149225157 D764G T C missense Het probably damaging 0.998 phenotype 06/26/2019
22 561901 UTSW Lztr1 1.000 R7222 G1 225.01 Y 16 17524132 E657G A G missense Het possibly damaging 0.860 0.186 phenotype 06/26/2019
23 561876 UTSW Mmd2 0.000 R7222 G1 225.01 Y 5 142567927 L160I G T missense Het probably benign 0.044 phenotype 06/26/2019
24 561884 UTSW Muc2 0.079 R7222 G1 225.01 Y 7 141704209 T15S A T missense Het phenotype 06/26/2019
25 561883 UTSW Muc6 0.098 R7222 G1 225.01 Y 7 141634515 H2835L T A missense Het unknown phenotype 06/26/2019
26 561874 UTSW Myo1h 1.000 R7222 G1 225.01 Y 5 114355261 G A critical splice donor site 1 bp Het probably null 06/26/2019
27 561863 UTSW Olfr1173 0.073 R7222 G1 225.01 Y 2 88274465 M195L T A missense Het probably benign 0.001 0.119 phenotype 06/26/2019
28 561908 UTSW Olfr1417 0.073 R7222 G1 225.01 Y 19 11828657 R123L C A missense Het probably damaging 0.994 phenotype 06/26/2019
29 561881 UTSW Olfr497 0.079 R7222 G1 225.01 Y 7 108422637 D22G A G missense Het probably benign 0.003 phenotype 06/26/2019
30 561879 UTSW Olfr610 0.074 R7222 G1 225.01 Y 7 103506457 V163A A G missense Het possibly damaging 0.503 phenotype 06/26/2019
31 561880 UTSW Olfr658 0.051 R7222 G1 225.01 Y 7 104644730 D214G T C missense Het probably damaging 1.000 phenotype 06/26/2019
32 561893 UTSW Olfr818 0.054 R7222 G1 225.01 Y 10 129945889 Y58H A G missense Het probably damaging 1.000 0.028 phenotype 06/26/2019
33 561888 UTSW Olfr850 0.201 R7222 G1 225.01 Y 9 19477467 V261E A T missense Het probably damaging 0.999 0.280 phenotype 06/26/2019
34 561894 UTSW Osbpl7 0.234 R7222 G1 225.01 Y 11 97060538 T684A A G missense Het probably damaging 1.000 0.554 phenotype 06/26/2019
35 561864 UTSW P2ry14 0.000 R7222 G1 225.01 Y 3 59115382 K219R T C missense Het probably benign 0.002 phenotype 06/26/2019
36 561899 UTSW Pde4d 0.000 R7222 G1 225.01 Y 13 109757579 H156L A T missense Het probably damaging 0.998 phenotype 06/26/2019
37 561902 UTSW Polq 0.338 R7222 G1 225.01 Y 16 37086633 E2319* G T nonsense Het probably null 0.504 phenotype 06/26/2019
38 561907 UTSW Ranbp3 0.953 R7222 G1 225.01 Y 17 56710211 V409G T G missense Het probably damaging 0.997 phenotype 06/26/2019
39 561873 UTSW Sart3 0.968 R7222 G1 225.01 Y 5 113746656 D629G T C missense Het probably benign 0.008 phenotype 06/26/2019
40 561866 UTSW Selenon 0.000 R7222 G1 225.01 Y 4 134547977 T137S T A missense Het possibly damaging 0.601 0.144 phenotype 06/26/2019
41 561892 UTSW Setd2 0.958 R7222 G1 225.01 Y 9 110551462 D55E T A missense Het 0.242 phenotype 06/26/2019
42 561861 UTSW Slamf8 0.000 R7222 G1 225.01 Y 1 172584208 T240I G A missense Het possibly damaging 0.726 phenotype 06/26/2019
43 561859 UTSW Slc39a10 0.557 R7222 G1 225.01 Y 1 46819292 L615P A G missense Het possibly damaging 0.818 0.058 phenotype 06/26/2019
44 561898 UTSW Tbce 1.000 R7222 G1 225.01 Y 13 13998150 D505G T C missense Het probably damaging 0.999 phenotype 06/26/2019
45 561886 UTSW Tenm3 0.463 R7222 G1 225.01 Y 8 48300969 G800R C T missense Het probably damaging 1.000 phenotype 06/26/2019
46 561887 UTSW Terf2ip 1.000 R7222 G1 225.01 Y 8 112011915 V145A T C missense Het possibly damaging 0.640 0.098 phenotype 06/26/2019
47 561903 UTSW Tmprss7 0.108 R7222 G1 225.01 Y 16 45690893 I41V T C missense Het probably benign 0.000 0.058 06/26/2019
48 561900 UTSW Traj49 R7222 G1 225.01 Y 14 54168703 N6I A T missense Het 0.055 06/26/2019
49 568683 UTSW Trim30a 0.078 R7222 G1 225.01 Y 7 104421432 T C splice site 3 bp Het probably null phenotype 09/11/2019
50 561867 UTSW Ubr4 1.000 R7222 G1 225.01 Y 4 139463373 S905T T A missense Het unknown phenotype 06/26/2019
51 561906 UTSW Zfp948 0.116 R7222 G1 225.01 Y 17 21587840 H431Q T A missense Het probably damaging 0.999 0.028 06/26/2019
52 561897 UTSW Zfyve1 0.000 R7222 G1 225.01 Y 12 83555005 F525L A G missense Het probably benign 0.000 phenotype 06/26/2019
[records 1 to 52 of 52]