Incidental Mutations

80 incidental mutations are currently displayed, and affect 80 genes.
16 are Possibly Damaging.
25 are Probably Damaging.
31 are Probably Benign.
3 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 564553 UTSW 2310057J18Rik 0.000 R7260 G1 225.01 N 10 28973886 S293P A G missense Het probably benign 0.066 06/26/2019
2 564564 UTSW Actn2 0.660 R7260 G1 225.01 N 13 12276490 N676S T C missense Het probably benign 0.001 phenotype 06/26/2019
3 564545 UTSW Amfr 0.791 R7260 G1 225.01 N 8 93976148 M463I C T missense Het possibly damaging 0.802 phenotype 06/26/2019
4 564550 UTSW Ankdd1a 0.184 R7260 G1 225.01 N 9 65504552 A325D G T missense Het probably damaging 0.965 06/26/2019
5 564534 UTSW Apba2 0.339 R7260 G1 225.01 N 7 64739745 D463G A G missense Het probably damaging 1.000 phenotype 06/26/2019
6 564554 UTSW Arid5b 0.875 R7260 G1 225.01 N 10 68097807 V755A A G missense Het probably damaging 0.998 phenotype 06/26/2019
7 564571 UTSW Boc 0.000 R7260 G1 225.01 N 16 44490170 F796I A T missense Het phenotype 06/26/2019
8 564569 UTSW Ccnt1 0.941 R7260 G1 225.01 N 15 98565124 Q56* G A nonsense Het probably null phenotype 06/26/2019
9 564585 UTSW Cd248 0.369 R7260 G1 225.01 N 19 5069355 Y410* T A nonsense Het probably null phenotype 06/26/2019
10 564544 UTSW Chd9 0.000 R7260 G1 225.01 N 8 90994543 N986K T A missense Het unknown 06/26/2019
11 564552 UTSW Col6a6 0.095 R7260 G1 225.01 N 9 105783969 T314A T C missense Het probably benign 0.005 06/26/2019
12 564570 UTSW Cpped1 0.062 R7260 G1 225.01 N 16 11828463 F142L A G missense Het possibly damaging 0.901 06/26/2019
13 564540 UTSW Csmd1 0.000 R7260 G1 225.01 N 8 16000574 A2221T C T missense Het probably damaging 0.999 phenotype 06/26/2019
14 564590 UTSW Cyp2c69 0.059 R7260 G1 225.01 N 19 39842900 V490L C A missense Het probably benign 0.002 06/26/2019
15 564517 UTSW Dcst2 0.255 R7260 G1 225.01 N 3 89366286 F157S T C missense Het probably damaging 1.000 06/26/2019
16 564528 UTSW Ddx54 1.000 R7260 G1 225.01 N 5 120626920 R788L G T missense Het probably benign 0.207 phenotype 06/26/2019
17 564566 UTSW Dnah1 0.000 R7260 G1 225.01 N 14 31269386 Y3145C T C missense Het probably damaging 1.000 phenotype 06/26/2019
18 564513 UTSW Dnah14 0.071 R7260 G1 225.01 N 1 181706744 R2320W A T missense Het probably damaging 0.993 phenotype 06/26/2019
19 564530 UTSW E130309D02Rik 0.958 R7260 G1 225.01 N 5 143311839 V151A A G missense Het probably benign 0.000 06/26/2019
20 564579 UTSW Emilin2 0.097 R7260 G1 225.01 N 17 71274790 T314A T C missense Het probably benign 0.001 phenotype 06/26/2019
21 564533 UTSW Eml2 0.000 R7260 G1 225.01 N 7 19200590 S405G A G missense Het probably benign 0.452 06/26/2019
22 564522 UTSW Ephb2 0.737 R7260 G1 225.01 N 4 136771574 F65L A G missense Het probably damaging 0.961 phenotype 06/26/2019
23 564567 UTSW Fam49b 0.120 R7260 G1 225.01 N 15 63957589 F23L A T missense Het possibly damaging 0.653 06/26/2019
24 564582 UTSW Fbn2 0.884 R7260 G1 225.01 N 18 58066116 D1360G T C missense Het probably benign 0.140 phenotype 06/26/2019
25 564549 UTSW Fbxo22 0.000 R7260 G1 225.01 N 9 55218470 T206A A G missense Het probably benign 0.004 phenotype 06/26/2019
26 564572 UTSW Filip1l 0.000 R7260 G1 225.01 N 16 57570924 E625G A G missense Het probably damaging 0.999 06/26/2019
27 564561 UTSW Gen1 0.150 R7260 G1 225.01 N 12 11256848 M172R A C missense Het probably damaging 0.986 phenotype 06/26/2019
28 564551 UTSW Gk5 0.000 R7260 G1 225.01 N 9 96119610 K54E A G missense Het probably benign 0.103 phenotype 06/26/2019
29 564588 UTSW Glis3 0.242 R7260 G1 225.01 N 19 28531402 E394G T C missense Het probably benign 0.000 phenotype 06/26/2019
30 564541 UTSW Gm16486 0.222 R7260 G1 225.01 N 8 70708748 Y197H T C missense Het probably benign 0.005 06/26/2019
31 564526 UTSW Helq 0.000 R7260 G1 225.01 N 5 100791927 E373D T A missense Het probably damaging 1.000 phenotype 06/26/2019
32 564563 UTSW Ighv1-74 0.139 R7260 G1 225.01 N 12 115802752 F83L A G missense Het probably benign 0.368 06/26/2019
33 564547 UTSW Kdm4d 0.000 R7260 G1 225.01 N 9 14463158 D468G T C missense Het probably benign 0.049 phenotype 06/26/2019
34 564589 UTSW Kif20b 0.841 R7260 G1 225.01 N 19 34950210 I957M A G missense Het probably damaging 0.996 phenotype 06/26/2019
35 564574 UTSW Ldhal6b 0.160 R7260 G1 225.01 N 17 5418260 F133S A G missense Het possibly damaging 0.717 06/26/2019
36 564584 UTSW Loxhd1 0.319 R7260 G1 225.01 N 18 77332642 Y321H T C missense Het possibly damaging 0.931 phenotype 06/26/2019
37 564580 UTSW Ltbp1 1.000 R7260 G1 225.01 N 17 75066144 M261L A T missense Het probably benign 0.007 phenotype 06/26/2019
38 564537 UTSW Mical2 0.140 R7260 G1 225.01 N 7 112319794 Q430L A T missense Het probably benign 0.102 phenotype 06/26/2019
39 564568 UTSW Mroh4 0.000 R7260 G1 225.01 N 15 74608129 N885K A T missense Het possibly damaging 0.835 06/26/2019
40 564586 UTSW Ms4a7 0.078 R7260 G1 225.01 N 19 11322346 Y231H A G missense Het probably damaging 1.000 phenotype 06/26/2019
41 564581 UTSW Msh2 0.807 R7260 G1 225.01 N 17 87717619 V642F G T missense Het probably damaging 0.967 phenotype 06/26/2019
42 564539 UTSW Muc5b 0.195 R7260 G1 225.01 N 7 141842648 A166S G T missense Het unknown phenotype 06/26/2019
43 564527 UTSW Myo18b 1.000 R7260 G1 225.01 N 5 112775288 I1868V T C missense Het probably benign 0.012 phenotype 06/26/2019
44 564546 UTSW Nfatc3 1.000 R7260 G1 225.01 N 8 106108946 S975P T C missense Het probably benign 0.002 phenotype 06/26/2019
45 564583 UTSW Oacyl 0.070 R7260 G1 225.01 N 18 65698367 L25P T C missense Het probably damaging 0.999 06/26/2019
46 564514 UTSW Olfr1145 0.061 R7260 G1 225.01 N 2 87810387 N189S A G missense Het probably damaging 0.978 phenotype 06/26/2019
47 564587 UTSW Olfr1463 0.068 R7260 G1 225.01 N 19 13235024 F258S T C missense Het probably damaging 0.977 phenotype 06/26/2019
48 564548 UTSW Olfr151 R7260 G1 225.01 N 9 37730753 I77F T A missense Het probably damaging 0.980 phenotype 06/26/2019
49 564558 UTSW Olfr816 0.072 R7260 G1 225.01 N 10 129912287 T A start gained Het probably benign phenotype 06/26/2019
50 564520 UTSW Patj 0.000 R7260 G1 225.01 N 4 98416733 I275V A G missense Het possibly damaging 0.944 phenotype 06/26/2019
51 564591 UTSW Pdcd11 0.966 R7260 G1 225.01 N 19 47129234 R1674Q G A missense Het possibly damaging 0.616 phenotype 06/26/2019
52 564531 UTSW Peg10 1.000 R7260 G1 198.47 N 6 4756398 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG small deletion Het probably benign phenotype 06/26/2019
53 564543 UTSW Phkb 0.791 R7260 G1 225.01 N 8 85878130 Y55N T A missense Het probably benign 0.067 phenotype 06/26/2019
54 564556 UTSW Pias4 0.950 R7260 G1 225.01 N 10 81157468 V207A A G missense Het possibly damaging 0.955 phenotype 06/26/2019
55 564532 UTSW Plxna4 0.549 R7260 G1 225.01 N 6 32239520 R540L C A missense Het possibly damaging 0.792 phenotype 06/26/2019
56 564525 UTSW Psapl1 0.060 R7260 G1 225.01 N 5 36205212 V383M G A missense Het probably benign 0.012 phenotype 06/26/2019
57 564559 UTSW Rars 0.968 R7260 G1 225.01 N 11 35834454 A10S C A missense Het probably benign 0.001 phenotype 06/26/2019
58 564555 UTSW Rhobtb1 0.149 R7260 G1 225.01 N 10 69270780 K454* A T nonsense Het probably null phenotype 06/26/2019
59 564560 UTSW Rnf213 0.000 R7260 G1 225.01 N 11 119452575 I3589V A G missense Het phenotype 06/26/2019
60 564519 UTSW Rngtt 0.967 R7260 G1 225.01 N 4 33356176 S338P T C missense Het possibly damaging 0.524 06/26/2019
61 564573 UTSW Sh3bgr 0.171 R7260 G1 225.01 N 16 96224481 E189G A G missense Het unknown 06/26/2019
62 564524 UTSW Slc30a3 0.235 R7260 G1 225.01 N 5 31088346 T281I G A missense Het probably damaging 0.988 phenotype 06/26/2019
63 564529 UTSW Smok3c 0.501 R7260 G1 225.01 N 5 138065623 D457E T A missense Het possibly damaging 0.842 06/26/2019
64 564515 UTSW Stard9 0.190 R7260 G1 225.01 N 2 120706938 Q4274K C A missense Het possibly damaging 0.904 06/26/2019
65 564562 UTSW Syne2 0.483 R7260 G1 225.01 N 12 75945079 L1938F G T missense Het probably damaging 1.000 phenotype 06/26/2019
66 564512 UTSW Tmem70 1.000 R7260 G1 225.01 N 1 16665366 T20K C A missense Het possibly damaging 0.580 phenotype 06/26/2019
67 564538 UTSW Tnrc6a 0.854 R7260 G1 225.01 N 7 123186590 E1502G A G missense Het probably benign 0.364 phenotype 06/26/2019
68 564536 UTSW Tpp1 1.000 R7260 G1 225.01 N 7 105747497 S438T A T missense Het probably benign 0.003 phenotype 06/26/2019
69 564565 UTSW Tubb2a 0.000 R7260 G1 225.01 N 13 34075414 Q131L T A missense Het probably damaging 0.998 phenotype 06/26/2019
70 564516 UTSW Ube2v1 0.834 R7260 G1 225.01 N 2 167629194 S26P A G missense Het probably benign 0.016 phenotype 06/26/2019
71 564542 UTSW Unc13a 1.000 R7260 G1 225.01 N 8 71660585 S207R G T missense Het possibly damaging 0.713 phenotype 06/26/2019
72 564535 UTSW Usp35 0.124 R7260 G1 225.01 N 7 97320079 D362A T G missense Het probably damaging 0.975 06/26/2019
73 564557 UTSW Utp20 0.957 R7260 G1 225.01 N 10 88751472 I2487T A G missense Het probably benign 0.390 phenotype 06/26/2019
74 564576 UTSW Vmn2r111 0.090 R7260 G1 225.01 N 17 22559051 N549S T C missense Het possibly damaging 0.502 0.068 06/26/2019
75 564577 UTSW Vmn2r117 0.405 R7260 G1 122.01 N 17 23475385 H496L T A missense Het probably benign 0.058 06/26/2019
76 564575 UTSW Vmn2r92 0.080 R7260 G1 225.01 N 17 18166876 A159V C T missense Het probably damaging 0.997 06/26/2019
77 564518 UTSW Wdr63 0.131 R7260 G1 225.01 N 3 146046540 M794L T A missense Het probably benign 0.013 06/26/2019
78 564578 UTSW Wiz 1.000 R7260 G1 225.01 N 17 32359111 K467E T C missense Het probably damaging 0.991 phenotype 06/26/2019
79 564523 UTSW Zfp534 0.240 R7260 G1 175.01 N 4 147675004 T403A T C missense Het probably benign 0.030 06/26/2019
80 564521 UTSW Zswim5 0.000 R7260 G1 225.01 N 4 116962646 L416P T C missense Het probably damaging 1.000 06/26/2019
[records 1 to 80 of 80]