Mutagenetix > Incidental Mutation

Incidental Mutation 'R1260:Mertk'

151570

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

MER proto-oncogene tyrosine kinase

Synonyms

nmf12, Tyro 12, Nyk, Eyk, Mer

MMRRC Submission

039327-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R1260 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128540876-128644814 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128604072 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 402 (K402R)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: K402R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: K402R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Btnl9	T	C	11: 49,060,371 (GRCm39)	E374G	probably damaging	Het
Car2	G	A	3: 14,960,640 (GRCm39)	A133T	probably damaging	Het
Chmp7	C	T	14: 69,956,899 (GRCm39)	M336I	probably benign	Het
Cpa6	T	C	1: 10,395,544 (GRCm39)		probably null	Het
Iqgap3	A	G	3: 88,021,330 (GRCm39)	H462R	probably benign	Het
Ltbp1	A	G	17: 75,532,280 (GRCm39)	Q118R	possibly damaging	Het
Med7	C	G	11: 46,331,460 (GRCm39)	I18M	probably damaging	Het
Myh7	T	A	14: 55,225,908 (GRCm39)	I478F	probably benign	Het
Or14j10	T	A	17: 37,934,594 (GRCm39)	T311S	probably benign	Het
Pdp2	T	C	8: 105,321,249 (GRCm39)	V366A	probably damaging	Het
Plin4	A	T	17: 56,411,348 (GRCm39)	C894*	probably null	Het
Plxnc1	A	G	10: 94,667,227 (GRCm39)	V1149A	probably damaging	Het
Rassf9	G	A	10: 102,348,446 (GRCm39)		probably null	Het
Rfwd3	C	T	8: 112,014,874 (GRCm39)	R326Q	probably damaging	Het
Shf	G	A	2: 122,199,163 (GRCm39)	P51S	probably damaging	Het
Stab1	T	C	14: 30,873,846 (GRCm39)	D984G	probably damaging	Het
Usp45	T	C	4: 21,826,204 (GRCm39)	S675P	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128,625,887 (GRCm39)	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128,578,556 (GRCm39)	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128,571,195 (GRCm39)	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128,643,210 (GRCm39)	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128,643,190 (GRCm39)	missense	probably benign
IGL02962:Mertk	APN	2	128,619,374 (GRCm39)	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128,632,192 (GRCm39)	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128,624,537 (GRCm39)	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128,601,086 (GRCm39)	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128,624,541 (GRCm39)	splice site	probably benign
R0491:Mertk	UTSW	2	128,635,027 (GRCm39)	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128,613,403 (GRCm39)	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128,580,233 (GRCm39)	missense	probably damaging	1.00
R1406:Mertk	UTSW	2	128,613,406 (GRCm39)	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128,613,406 (GRCm39)	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128,620,883 (GRCm39)	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128,632,248 (GRCm39)	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128,624,446 (GRCm39)	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128,643,556 (GRCm39)	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128,592,094 (GRCm39)	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128,604,132 (GRCm39)	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128,643,116 (GRCm39)	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128,601,010 (GRCm39)	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128,636,378 (GRCm39)	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128,604,058 (GRCm39)	missense	probably benign
R2178:Mertk	UTSW	2	128,634,984 (GRCm39)	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128,643,392 (GRCm39)	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128,619,358 (GRCm39)	nonsense	probably null
R4664:Mertk	UTSW	2	128,643,132 (GRCm39)	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128,593,914 (GRCm39)	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128,643,225 (GRCm39)	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128,624,496 (GRCm39)	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128,592,079 (GRCm39)	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128,625,845 (GRCm39)	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128,625,920 (GRCm39)	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128,580,167 (GRCm39)	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128,571,375 (GRCm39)	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128,643,234 (GRCm39)	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128,613,384 (GRCm39)	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128,578,485 (GRCm39)	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128,580,227 (GRCm39)	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128,613,321 (GRCm39)	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128,613,294 (GRCm39)	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128,580,211 (GRCm39)	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128,618,341 (GRCm39)	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128,593,943 (GRCm39)	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128,571,277 (GRCm39)	missense	probably benign
R6841:Mertk	UTSW	2	128,601,150 (GRCm39)	splice site	probably null
R7153:Mertk	UTSW	2	128,578,569 (GRCm39)	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128,635,028 (GRCm39)	splice site	probably null
R7225:Mertk	UTSW	2	128,643,482 (GRCm39)	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128,613,417 (GRCm39)	missense	probably benign
R7414:Mertk	UTSW	2	128,571,313 (GRCm39)	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128,618,265 (GRCm39)	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128,613,418 (GRCm39)	missense	probably benign
R8953:Mertk	UTSW	2	128,620,716 (GRCm39)	intron	probably benign
R9135:Mertk	UTSW	2	128,604,035 (GRCm39)	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128,624,487 (GRCm39)	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128,620,892 (GRCm39)	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128,604,029 (GRCm39)	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128,593,880 (GRCm39)	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128,624,527 (GRCm39)	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128,643,255 (GRCm39)	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128,571,487 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGAGGACTCTCTTGCCTAGACC -3'
(R):5'- GTGCCTTGCCTTGCTCAATGATAAC -3'

Sequencing Primer
(F):5'- gctgacatcaaattcatagagatcc -3'
(R):5'- GCCTTGCTCAATGATAACAAGTG -3'

Posted On

2014-01-29