Incidental Mutation 'R1319:Olfr262'
ID157650
Institutional Source Beutler Lab
Gene Symbol Olfr262
Ensembl Gene ENSMUSG00000067519
Gene Nameolfactory receptor 262
SynonymsMOR214-1, GA_x6K02T2N4A9-18144-19082, MOR214-9
MMRRC Submission 039385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1319 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12240721-12241659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12241502 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000085120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087818]
Predicted Effect probably damaging
Transcript: ENSMUST00000087818
AA Change: D53G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085120
Gene: ENSMUSG00000067519
AA Change: D53G

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.3e-55 PFAM
Pfam:7tm_1 42 291 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A T 2: 173,527,923 S77C probably damaging Het
Adam28 T C 14: 68,609,129 E745G probably benign Het
Adamts12 G T 15: 11,286,791 K827N probably benign Het
Ang2 T C 14: 51,195,707 T73A probably benign Het
Bbs10 T C 10: 111,298,874 L51P probably damaging Het
Bean1 T C 8: 104,217,224 I137T probably benign Het
Cttnbp2 T C 6: 18,434,630 T410A probably benign Het
Cyp4a10 A C 4: 115,521,145 I143L probably damaging Het
Dlg2 A T 7: 92,438,023 Q788L probably damaging Het
Epha10 G A 4: 124,881,914 V14I probably benign Het
Eprs G A 1: 185,384,962 D401N probably damaging Het
Fam169a T C 13: 97,097,562 V114A probably damaging Het
Fbn2 G A 18: 58,200,610 P178S possibly damaging Het
Fcrls A C 3: 87,262,177 probably null Het
Grm1 G T 10: 10,689,398 H1055Q probably benign Het
Mcm6 T C 1: 128,349,052 N267S probably benign Het
Phc3 T C 3: 30,929,869 I699V probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pyroxd1 T C 6: 142,359,148 V367A probably benign Het
R3hdm1 G A 1: 128,231,405 R939H probably benign Het
Rag1 A T 2: 101,643,192 I535N probably damaging Het
Rhot1 T C 11: 80,246,021 C310R probably damaging Het
Tnrc6a G A 7: 123,184,251 V1481M probably benign Het
Vmn1r234 A T 17: 21,228,910 M29L probably benign Het
Vmn2r68 A G 7: 85,232,492 I460T probably damaging Het
Zfhx3 T A 8: 108,933,833 Y1240N probably damaging Het
Other mutations in Olfr262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr262 APN 19 12241527 missense probably damaging 0.99
IGL02170:Olfr262 APN 19 12240756 missense probably benign
IGL02748:Olfr262 APN 19 12240840 missense probably benign 0.01
IGL02896:Olfr262 APN 19 12240989 nonsense probably null
R0365:Olfr262 UTSW 19 12241076 missense probably benign 0.13
R0374:Olfr262 UTSW 19 12241141 missense probably damaging 1.00
R1226:Olfr262 UTSW 19 12241586 missense probably benign
R1426:Olfr262 UTSW 19 12241182 missense possibly damaging 0.81
R1453:Olfr262 UTSW 19 12241592 missense probably benign
R1675:Olfr262 UTSW 19 12240831 missense probably benign 0.37
R1773:Olfr262 UTSW 19 12241659 start codon destroyed probably null 0.03
R1778:Olfr262 UTSW 19 12241455 missense probably benign
R1820:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R3161:Olfr262 UTSW 19 12241496 missense probably benign 0.06
R3412:Olfr262 UTSW 19 12241590 missense probably benign 0.00
R4387:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4389:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4782:Olfr262 UTSW 19 12241572 missense probably benign 0.01
R4885:Olfr262 UTSW 19 12240718 unclassified probably null
R4915:Olfr262 UTSW 19 12241373 missense probably benign 0.31
R5254:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R5726:Olfr262 UTSW 19 12241280 missense probably damaging 0.99
R6579:Olfr262 UTSW 19 12241362 missense probably benign
R7062:Olfr262 UTSW 19 12240725 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACCATCAGTACACAAAGAGTGGG -3'
(R):5'- TGATTGCCAGGGGAAACAGCAC -3'

Sequencing Primer
(F):5'- TGGGTGACATAATCGATGCATAC -3'
(R):5'- GCACAGAGATCACCCAGTTC -3'
Posted On2014-02-18