Incidental Mutation 'R1596:Fam83c'
ID175787
Institutional Source Beutler Lab
Gene Symbol Fam83c
Ensembl Gene ENSMUSG00000074647
Gene Namefamily with sequence similarity 83, member C
Synonyms
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155827548-155834854 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 155831062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029142] [ENSMUST00000029143] [ENSMUST00000109638] [ENSMUST00000129830] [ENSMUST00000134278] [ENSMUST00000154841]
Predicted Effect probably benign
Transcript: ENSMUST00000029142
SMART Domains Protein: ENSMUSP00000029142
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 204 2.72e-136 SMART
Predicted Effect probably null
Transcript: ENSMUST00000029143
SMART Domains Protein: ENSMUSP00000029143
Gene: ENSMUSG00000074647

DomainStartEndE-ValueType
Pfam:DUF1669 61 337 3.1e-107 PFAM
low complexity region 347 357 N/A INTRINSIC
low complexity region 368 385 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
low complexity region 474 484 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109638
SMART Domains Protein: ENSMUSP00000105266
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 70 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129830
SMART Domains Protein: ENSMUSP00000120206
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 68 4.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134278
SMART Domains Protein: ENSMUSP00000123190
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 1 58 5.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141926
Predicted Effect probably benign
Transcript: ENSMUST00000154841
SMART Domains Protein: ENSMUSP00000115715
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 45 7.8e-10 PFAM
Meta Mutation Damage Score 0.678 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Fam83c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam83c APN 2 155834442 missense probably damaging 1.00
IGL01470:Fam83c APN 2 155834808 missense possibly damaging 0.73
IGL02695:Fam83c APN 2 155831515 missense probably benign 0.04
R0255:Fam83c UTSW 2 155829752 missense probably benign 0.00
R0321:Fam83c UTSW 2 155829700 missense probably benign
R0449:Fam83c UTSW 2 155830295 missense probably benign 0.00
R1635:Fam83c UTSW 2 155830051 missense possibly damaging 0.95
R2006:Fam83c UTSW 2 155830303 missense probably benign 0.04
R2165:Fam83c UTSW 2 155831524 missense possibly damaging 0.94
R3840:Fam83c UTSW 2 155834748 missense probably benign
R3841:Fam83c UTSW 2 155834748 missense probably benign
R4693:Fam83c UTSW 2 155830234 missense probably damaging 1.00
R5660:Fam83c UTSW 2 155829589 missense probably benign 0.08
R6364:Fam83c UTSW 2 155834523 missense probably damaging 1.00
R6563:Fam83c UTSW 2 155830952 missense probably damaging 0.98
R6976:Fam83c UTSW 2 155830237 missense possibly damaging 0.63
R7124:Fam83c UTSW 2 155829571 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCGAGCCGTAAGATCTCAGATGC -3'
(R):5'- CCTTTAGCTTTGAGGGACTGGACAC -3'

Sequencing Primer
(F):5'- ATGCCCTTACCAGGTAATGG -3'
(R):5'- gtatgtggtgctcatggagg -3'
Posted On2014-04-24