Incidental Mutation 'R1347:Mrpl44'
ID 186155
Institutional Source Beutler Lab
Gene Symbol Mrpl44
Ensembl Gene ENSMUSG00000026248
Gene Name mitochondrial ribosomal protein L44
Synonyms 5730593H20Rik, 1810030E18Rik
MMRRC Submission 039412-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1347 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 79753735-79759162 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79755669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 92 (F92I)
Ref Sequence ENSEMBL: ENSMUSP00000027464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027464] [ENSMUST00000143368]
AlphaFold Q9CY73
Predicted Effect probably damaging
Transcript: ENSMUST00000027464
AA Change: F92I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027464
Gene: ENSMUSG00000026248
AA Change: F92I

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
PDB:4CE4|H 67 333 1e-160 PDB
SCOP:d1jfza_ 72 224 5e-23 SMART
Blast:RIBOc 86 228 2e-90 BLAST
Blast:DSRM 237 288 6e-8 BLAST
SCOP:d1di2a_ 237 304 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143368
SMART Domains Protein: ENSMUSP00000123303
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
Blast:WD40 145 182 6e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189176
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G T 3: 152,239,071 (GRCm39) D301E probably damaging Het
Arpc1a G T 5: 145,034,082 (GRCm39) W150L probably damaging Het
Filip1l A G 16: 57,391,350 (GRCm39) D646G probably damaging Het
Foxa1 A T 12: 57,589,070 (GRCm39) H383Q probably damaging Het
Fpr-rs6 T C 17: 20,403,011 (GRCm39) T117A probably benign Het
Fry A T 5: 150,419,283 (GRCm39) E905V probably damaging Het
Furin C T 7: 80,041,932 (GRCm39) probably benign Het
Glyr1 T C 16: 4,839,203 (GRCm39) D338G probably damaging Het
Gpd2 A T 2: 57,247,683 (GRCm39) K542M probably damaging Het
Itpr3 T C 17: 27,330,535 (GRCm39) F1679L probably benign Het
Kif23 A G 9: 61,834,438 (GRCm39) M427T probably damaging Het
Kpna1 T A 16: 35,829,696 (GRCm39) I83N probably benign Het
Man2a1 T C 17: 65,019,445 (GRCm39) F770L probably damaging Het
Myh4 A G 11: 67,135,567 (GRCm39) probably benign Het
Or2a56 A C 6: 42,932,639 (GRCm39) D69A probably damaging Het
Or5b105 T C 19: 13,080,054 (GRCm39) I199V probably benign Het
Rbm15 G T 3: 107,239,946 (GRCm39) R151S possibly damaging Het
Rims3 G A 4: 120,740,322 (GRCm39) G90S probably damaging Het
Rock2 G A 12: 17,027,625 (GRCm39) C1314Y possibly damaging Het
Serpinb6e C T 13: 34,025,180 (GRCm39) C37Y possibly damaging Het
Spata31d1c C T 13: 65,183,202 (GRCm39) T248I probably benign Het
Tbx15 C A 3: 99,259,427 (GRCm39) Q433K possibly damaging Het
Vmn1r11 G A 6: 57,114,963 (GRCm39) C209Y probably benign Het
Zfhx3 T C 8: 109,527,330 (GRCm39) probably benign Het
Zim1 C A 7: 6,680,430 (GRCm39) C411F probably damaging Het
Other mutations in Mrpl44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Mrpl44 APN 1 79,758,721 (GRCm39) missense probably benign 0.01
IGL02633:Mrpl44 APN 1 79,753,862 (GRCm39) missense probably benign 0.02
R0054:Mrpl44 UTSW 1 79,757,212 (GRCm39) missense probably damaging 1.00
R0054:Mrpl44 UTSW 1 79,757,212 (GRCm39) missense probably damaging 1.00
R0909:Mrpl44 UTSW 1 79,757,370 (GRCm39) missense probably benign 0.43
R1180:Mrpl44 UTSW 1 79,755,677 (GRCm39) missense probably damaging 0.99
R1347:Mrpl44 UTSW 1 79,755,669 (GRCm39) missense probably damaging 1.00
R1448:Mrpl44 UTSW 1 79,755,677 (GRCm39) missense probably damaging 0.99
R3689:Mrpl44 UTSW 1 79,757,366 (GRCm39) nonsense probably null
R3690:Mrpl44 UTSW 1 79,757,366 (GRCm39) nonsense probably null
R4533:Mrpl44 UTSW 1 79,753,971 (GRCm39) missense possibly damaging 0.91
R4818:Mrpl44 UTSW 1 79,758,694 (GRCm39) missense probably benign 0.00
R4893:Mrpl44 UTSW 1 79,755,582 (GRCm39) missense probably damaging 0.97
R6178:Mrpl44 UTSW 1 79,755,895 (GRCm39) missense possibly damaging 0.76
R8713:Mrpl44 UTSW 1 79,755,708 (GRCm39) missense probably damaging 1.00
R8795:Mrpl44 UTSW 1 79,753,974 (GRCm39) missense probably damaging 0.99
X0018:Mrpl44 UTSW 1 79,755,792 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCAGAGCAGCCTAATGTGATGTG -3'
(R):5'- GGCAAGTCTGGGAATTCGTCTTCG -3'

Sequencing Primer
(F):5'- ACGGACTGCCAGTGGTTATC -3'
(R):5'- CTGGGAATTCGTCTTCGAGAAAC -3'
Posted On 2014-05-09