Incidental Mutation 'R1914:Abca6'
ID214705
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 039932-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1914 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110212210 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 852 (R852G)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably benign
Transcript: ENSMUST00000044003
AA Change: R852G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: R852G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,485,850 V618E possibly damaging Het
Akap12 G A 10: 4,356,685 R1165H probably benign Het
Asxl1 T C 2: 153,401,906 S1459P probably damaging Het
Bahcc1 C T 11: 120,285,399 R1957C probably damaging Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Capn15 C A 17: 25,964,863 A215S probably benign Het
Casz1 T C 4: 148,932,958 F235L probably damaging Het
Ccdc57 A T 11: 120,903,308 probably benign Het
Cdh23 A G 10: 60,323,570 V2142A probably damaging Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep104 T C 4: 153,989,839 L516P possibly damaging Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Diaph3 A C 14: 86,656,485 N29K probably damaging Het
Dnajc2 A G 5: 21,781,319 probably null Het
Ephb1 C T 9: 101,929,378 C819Y probably damaging Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Fezf2 A T 14: 12,343,988 V301E probably damaging Het
Fnbp4 T C 2: 90,779,193 probably benign Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gas6 T C 8: 13,477,152 T199A probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Grm4 A T 17: 27,434,712 C755S probably damaging Het
Hdgfl2 A G 17: 56,096,978 D278G probably damaging Het
Heatr5a G T 12: 51,905,467 A1130E probably damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Ing1 T A 8: 11,561,577 V63E probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Klf5 T C 14: 99,301,921 S177P probably benign Het
Lats1 T A 10: 7,710,457 probably benign Het
Lilrb4a A G 10: 51,491,949 I53M probably benign Het
Lrrc2 T A 9: 110,980,939 Y348N probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Med25 A G 7: 44,884,622 S245P probably benign Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Naip6 T A 13: 100,299,428 E862D probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nyap2 T C 1: 81,191,887 S120P probably damaging Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pappa2 A T 1: 158,750,563 D1721E probably damaging Het
Pcid2 A T 8: 13,094,141 probably null Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rabggta A T 14: 55,721,189 F62L possibly damaging Het
Rasal3 G A 17: 32,396,350 Q505* probably null Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsph4a A T 10: 33,913,072 N638Y probably damaging Het
Scn9a A G 2: 66,566,250 F100L probably damaging Het
Siglece A G 7: 43,657,795 V256A probably benign Het
Slc23a2 A T 2: 132,056,766 L617Q probably damaging Het
Snx9 T C 17: 5,928,256 I567T possibly damaging Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tbl1xr1 T C 3: 22,190,910 probably benign Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Trim43c T A 9: 88,840,617 D105E probably benign Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Vmn2r18 T C 5: 151,575,821 N393D probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTCTTCAGTAATGTATTCCAC -3'
(R):5'- CTAAAGGTGGTGATGTTATACAAGC -3'

Sequencing Primer
(F):5'- GCAACCATAATGTTAAGTGCTGAC -3'
(R):5'- GGTGATGTTATACAAGCTTAATGAGG -3'
Posted On2014-07-14