Incidental Mutation 'R2291:Pigg'
ID244341
Institutional Source Beutler Lab
Gene Symbol Pigg
Ensembl Gene ENSMUSG00000029263
Gene Namephosphatidylinositol glycan anchor biosynthesis, class G
SynonymsGpi7
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108312609-108349355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108332917 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 389 (I389M)
Ref Sequence ENSEMBL: ENSMUSP00000112984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031189] [ENSMUST00000118910] [ENSMUST00000119014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031189
AA Change: I514M

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031189
Gene: ENSMUSG00000029263
AA Change: I514M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 68 314 6.3e-15 PFAM
transmembrane domain 428 450 N/A INTRINSIC
transmembrane domain 463 482 N/A INTRINSIC
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 540 562 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 688 705 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
transmembrane domain 785 802 N/A INTRINSIC
transmembrane domain 876 898 N/A INTRINSIC
transmembrane domain 911 933 N/A INTRINSIC
transmembrane domain 948 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118910
AA Change: I389M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112984
Gene: ENSMUSG00000029263
AA Change: I389M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SCOP:d1eqja2 127 202 8e-8 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 338 357 N/A INTRINSIC
transmembrane domain 372 394 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
transmembrane domain 563 580 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 624 641 N/A INTRINSIC
transmembrane domain 660 677 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 786 808 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119014
AA Change: I522M

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113818
Gene: ENSMUSG00000029263
AA Change: I522M

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 164 286 2.2e-9 PFAM
transmembrane domain 436 458 N/A INTRINSIC
transmembrane domain 471 490 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 548 570 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 793 810 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
transmembrane domain 919 941 N/A INTRINSIC
transmembrane domain 956 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in glycosylphosphatidylinositol-anchor biosynthesis. The encoded protein, which is localized to the endoplasmic reticulum, is involved in transferring ethanoloamine phosphate to mannose 2 of glycosylphosphatidylinositol species H7 to form species H8. Allelic variants of this gene have been associated with intellectual disability, hypotonia, and early-onset seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Ints7 T G 1: 191,606,203 probably null Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Pigg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Pigg APN 5 108342078 missense probably damaging 1.00
IGL01308:Pigg APN 5 108336477 missense probably damaging 1.00
IGL01485:Pigg APN 5 108336201 missense possibly damaging 0.90
IGL02043:Pigg APN 5 108344324 missense probably damaging 1.00
IGL02104:Pigg APN 5 108342097 missense probably damaging 1.00
IGL02238:Pigg APN 5 108318928 missense possibly damaging 0.64
IGL02311:Pigg APN 5 108336380 missense probably benign
IGL02608:Pigg APN 5 108313003 missense probably damaging 0.98
IGL03338:Pigg APN 5 108319950 missense probably damaging 1.00
P0033:Pigg UTSW 5 108342078 missense probably damaging 1.00
R0082:Pigg UTSW 5 108312885 start gained probably benign
R0449:Pigg UTSW 5 108336411 missense probably benign 0.00
R0616:Pigg UTSW 5 108314085 missense probably damaging 1.00
R1246:Pigg UTSW 5 108341820 missense probably damaging 0.99
R1368:Pigg UTSW 5 108317288 missense probably damaging 1.00
R1777:Pigg UTSW 5 108317391 missense probably damaging 1.00
R1898:Pigg UTSW 5 108336542 missense probably benign
R2022:Pigg UTSW 5 108312922 start gained probably benign
R2037:Pigg UTSW 5 108338652 missense probably damaging 1.00
R2157:Pigg UTSW 5 108318889 missense probably damaging 1.00
R2181:Pigg UTSW 5 108336500 missense probably damaging 0.96
R3157:Pigg UTSW 5 108314148 missense probably damaging 1.00
R4117:Pigg UTSW 5 108348042 missense probably benign 0.15
R4572:Pigg UTSW 5 108332885 missense probably benign 0.27
R4589:Pigg UTSW 5 108332690 missense probably benign
R5019:Pigg UTSW 5 108332149 missense probably damaging 1.00
R5094:Pigg UTSW 5 108336257 missense possibly damaging 0.90
R5329:Pigg UTSW 5 108314160 missense probably damaging 0.99
R5960:Pigg UTSW 5 108336294 missense probably benign 0.01
R5976:Pigg UTSW 5 108332191 missense probably null 1.00
R6089:Pigg UTSW 5 108341922 missense probably benign
R6797:Pigg UTSW 5 108332828 missense probably damaging 0.99
R6960:Pigg UTSW 5 108326841 missense probably damaging 0.98
R7090:Pigg UTSW 5 108336512 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAAAGGCTGAGCTGGATGTTC -3'
(R):5'- GCCTGGGGAGATATGCTTAG -3'

Sequencing Primer
(F):5'- CTGAGCTGGATGTTCCTCTG -3'
(R):5'- ATGATGTTTGGTCTTTCAAAGCACTG -3'
Posted On2014-10-30