Incidental Mutation 'R2972:D930007J09Rik'
ID255253
Institutional Source Beutler Lab
Gene Symbol D930007J09Rik
Ensembl Gene ENSMUSG00000042874
Gene NameRIKEN cDNA D930007J09 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R2972 (G1)
Quality Score211
Status Not validated
Chromosome13
Chromosomal Location32802457-32802849 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 32802759 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
Predicted Effect silent
Transcript: ENSMUST00000021832
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000057911
AA Change: A31T
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874
AA Change: A31T

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC048507 T C 13: 67,863,630 I42T probably benign Het
Card9 C T 2: 26,357,210 R309H probably damaging Het
Clec14a T A 12: 58,267,574 R421W probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Dhrs7c T A 11: 67,815,871 I285N possibly damaging Het
Golga2 A G 2: 32,305,659 N752S probably benign Het
Klrb1-ps1 A G 6: 129,119,756 noncoding transcript Het
Nin G A 12: 70,062,713 R151C probably damaging Het
Nsun6 A C 2: 15,038,072 probably null Het
Nyap2 C T 1: 81,191,770 R81* probably null Het
Olfr1241 G T 2: 89,482,776 R120S possibly damaging Het
Olfr354 G A 2: 36,907,404 V153M probably benign Het
Pkhd1l1 T A 15: 44,547,248 M2717K possibly damaging Het
Ralgapa1 T C 12: 55,820,755 K5E possibly damaging Het
Rnf130 T A 11: 50,093,800 L309* probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rxrg G A 1: 167,639,146 R422H probably damaging Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Vmn2r77 T C 7: 86,803,685 Y537H probably benign Het
Other mutations in D930007J09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2973:D930007J09Rik UTSW 13 32802759 unclassified probably benign
R2974:D930007J09Rik UTSW 13 32802759 unclassified probably benign
R5886:D930007J09Rik UTSW 13 32802836 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCACATCAATTCGCACCTG -3'
(R):5'- ATGTAGTCCTGCAGCGTGTC -3'

Sequencing Primer
(F):5'- TCAATTCGCACCTGGACCG -3'
(R):5'- GTCTGGACGCATCTTGTCAGC -3'
Posted On2014-12-29