Incidental Mutation 'R2054:Hao1'
List |< first << previous [record 87 of 217] next >> last >|
ID271608
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
MMRRC Submission 040059-MU
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2054 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to T at 134498258 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect silent
Transcript: ENSMUST00000028704
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,736 C94S possibly damaging Het
4932438A13Rik A G 3: 36,947,853 T1316A probably benign Het
4933417A18Rik T A 13: 34,924,591 Y19N probably damaging Het
9330182L06Rik C A 5: 9,463,030 T1008K possibly damaging Het
A930011G23Rik T C 5: 99,228,055 Y432C probably benign Het
Abtb2 A G 2: 103,705,117 D543G probably benign Het
Adam9 A T 8: 24,991,294 V318E probably damaging Het
Aim2 T C 1: 173,463,982 F318L probably damaging Het
Apob A T 12: 8,013,134 D3872V probably damaging Het
Atat1 T A 17: 35,901,369 R323W probably null Het
Atp2b4 T C 1: 133,715,169 D1066G probably benign Het
Caskin2 T C 11: 115,806,301 probably benign Het
Ccdc54 T A 16: 50,590,624 N93I probably damaging Het
Ccnd1 A C 7: 144,937,391 D159E possibly damaging Het
Cnot1 A C 8: 95,739,841 S1589R possibly damaging Het
Copa T A 1: 172,118,957 Y980* probably null Het
Defb19 A G 2: 152,576,170 I82T possibly damaging Het
Fiz1 G A 7: 5,008,236 R428C probably damaging Het
Fnip2 A T 3: 79,572,465 probably benign Het
Gabrb3 G A 7: 57,824,493 G408S probably benign Het
Gif G A 19: 11,759,006 V314I probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Hecw1 T A 13: 14,297,413 M557L probably damaging Het
Itch A T 2: 155,210,576 I699F probably damaging Het
Kmt2a T C 9: 44,823,374 probably benign Het
Leng8 T G 7: 4,144,290 Y562* probably null Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1b A T 2: 40,697,482 N151K unknown Het
Lrrc71 T C 3: 87,742,673 E316G probably damaging Het
Mgat5 A G 1: 127,397,607 N404D probably damaging Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Mtor A G 4: 148,462,852 T431A probably benign Het
Mtor T A 4: 148,466,025 C713S probably benign Het
Mug2 A G 6: 122,077,492 K1077E probably damaging Het
Nbas A G 12: 13,474,206 T1688A probably benign Het
Nek2 T C 1: 191,821,652 S3P possibly damaging Het
Nell2 T C 15: 95,435,109 T190A probably benign Het
Npr2 A T 4: 43,646,560 N636I probably damaging Het
Orc3 A T 4: 34,584,846 I453K probably damaging Het
Pcnx A G 12: 81,933,674 H865R probably benign Het
Pex1 T C 5: 3,603,341 V80A possibly damaging Het
Phka2 T A X: 160,554,327 D424E probably damaging Het
Pkd1 C T 17: 24,574,796 T1819I probably benign Het
Poglut1 T C 16: 38,534,807 D219G probably damaging Het
Ppargc1a T C 5: 51,473,788 I500V possibly damaging Het
Pygm C G 19: 6,388,155 N163K probably benign Het
Qrich1 T A 9: 108,559,270 N722K possibly damaging Het
Reep6 T A 10: 80,330,322 C104* probably null Het
Rfx8 A G 1: 39,685,559 V214A possibly damaging Het
Sis G A 3: 72,913,237 T1398I probably benign Het
Skint5 A G 4: 113,819,163 probably null Het
Slc7a14 A G 3: 31,237,362 probably benign Het
Smc2 T A 4: 52,462,948 M646K probably benign Het
Snx29 A G 16: 11,631,492 N165S probably damaging Het
Supt6 T A 11: 78,224,361 probably benign Het
Tead4 G T 6: 128,270,962 S37R probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tff2 T C 17: 31,143,225 K40E probably benign Het
Traip C T 9: 107,962,919 T265M probably benign Het
Trim47 T C 11: 116,108,283 T256A probably benign Het
Trpm1 A G 7: 64,240,555 M853V possibly damaging Het
Tti1 G T 2: 158,007,445 Q625K possibly damaging Het
Ube2n A G 10: 95,541,266 N31S probably damaging Het
Vmn2r17 T C 5: 109,452,486 M550T probably damaging Het
Zfp512 T A 5: 31,465,449 N31K probably benign Het
Zfp64 A G 2: 168,925,808 V628A probably damaging Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R0948:Hao1 UTSW 2 134530773 missense probably damaging 1.00
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3831:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3833:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3960:Hao1 UTSW 2 134522983 critical splice donor site probably null
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4635:Hao1 UTSW 2 134523152 missense probably damaging 1.00
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCCTAGGACACCCATTGAAAAG -3'
(R):5'- ATGCCACATAAGATTTGGCAAG -3'

Sequencing Primer
(F):5'- TAGGACACCCATTGAAAAGTCAAAAG -3'
(R):5'- CATAAGATTTGGCAAGCCTACC -3'
Posted On2015-03-23