Incidental Mutation 'R4001:Aipl1'
ID 312484
Institutional Source Beutler Lab
Gene Symbol Aipl1
Ensembl Gene ENSMUSG00000040554
Gene Name aryl hydrocarbon receptor-interacting protein-like 1
Synonyms A930007I01Rik
MMRRC Submission 040844-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R4001 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 71918789-71928335 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71922428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 94 (T94S)
Ref Sequence ENSEMBL: ENSMUSP00000061957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048207] [ENSMUST00000059082]
AlphaFold Q924K1
Predicted Effect possibly damaging
Transcript: ENSMUST00000048207
AA Change: T94S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036279
Gene: ENSMUSG00000040554
AA Change: T94S

DomainStartEndE-ValueType
Pfam:FKBP_C 26 154 5.2e-8 PFAM
Pfam:TPR_2 178 210 4.6e-6 PFAM
low complexity region 240 251 N/A INTRINSIC
Pfam:TPR_2 264 296 5.5e-6 PFAM
low complexity region 302 312 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059082
AA Change: T94S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061957
Gene: ENSMUSG00000040554
AA Change: T94S

DomainStartEndE-ValueType
Pfam:FKBP_C 25 154 1e-8 PFAM
Meta Mutation Damage Score 0.1613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display complete retinal degeneration and a lack of electroretinographic responses. Homozygous hypomorphic mutants display less severe retinal degeneration and impaired electroretinographic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 C A 8: 111,768,234 (GRCm39) H202N probably damaging Het
Cdhr2 A T 13: 54,866,079 (GRCm39) E293V probably benign Het
Chd9 C T 8: 91,683,185 (GRCm39) R542C probably damaging Het
Clip4 A T 17: 72,106,071 (GRCm39) I85L probably damaging Het
Cntnap5c G A 17: 58,714,735 (GRCm39) probably null Het
Fbn1 A G 2: 125,319,415 (GRCm39) probably null Het
Hivep2 A G 10: 14,003,476 (GRCm39) R25G probably damaging Het
Klhdc7b A G 15: 89,272,187 (GRCm39) N1023S probably damaging Het
Lipi T A 16: 75,370,759 (GRCm39) R153* probably null Het
Lpcat4 A T 2: 112,070,296 (GRCm39) Q3L probably benign Het
Naa16 C A 14: 79,580,561 (GRCm39) probably null Het
Nalcn G T 14: 123,834,006 (GRCm39) N56K probably damaging Het
Obscn C G 11: 59,025,395 (GRCm39) A412P probably damaging Het
Or1e23 A G 11: 73,407,812 (GRCm39) L71P probably damaging Het
Pde8a T A 7: 80,967,104 (GRCm39) L415Q probably damaging Het
Ppp4r3c1 T C X: 88,974,116 (GRCm39) I694V probably benign Het
Rbms2 C T 10: 127,987,169 (GRCm39) S13N probably benign Het
Rgsl1 A G 1: 153,693,330 (GRCm39) L617P probably damaging Het
Sap18b T C 8: 96,552,068 (GRCm39) V26A probably benign Het
Senp2 T C 16: 21,847,318 (GRCm39) L282P possibly damaging Het
Srcap T C 7: 127,131,339 (GRCm39) M826T probably damaging Het
Tmc3 T C 7: 83,269,271 (GRCm39) S820P probably benign Het
Tmprss3 T C 17: 31,405,533 (GRCm39) N353S probably damaging Het
Tro G A X: 149,438,198 (GRCm39) T153I probably benign Het
Trp53bp1 A G 2: 121,035,566 (GRCm39) S1562P probably damaging Het
Uaca G A 9: 60,778,366 (GRCm39) V916I probably benign Het
Other mutations in Aipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Aipl1 APN 11 71,922,373 (GRCm39) missense probably damaging 1.00
IGL01713:Aipl1 APN 11 71,927,449 (GRCm39) missense probably damaging 1.00
IGL02031:Aipl1 APN 11 71,921,028 (GRCm39) utr 3 prime probably benign
IGL02603:Aipl1 APN 11 71,927,526 (GRCm39) missense possibly damaging 0.82
IGL02677:Aipl1 APN 11 71,920,222 (GRCm39) missense possibly damaging 0.90
R1563:Aipl1 UTSW 11 71,927,538 (GRCm39) missense probably damaging 0.99
R1835:Aipl1 UTSW 11 71,921,325 (GRCm39) missense possibly damaging 0.91
R2041:Aipl1 UTSW 11 71,922,332 (GRCm39) missense possibly damaging 0.87
R2118:Aipl1 UTSW 11 71,920,195 (GRCm39) missense possibly damaging 0.92
R2216:Aipl1 UTSW 11 71,922,272 (GRCm39) missense probably damaging 1.00
R4969:Aipl1 UTSW 11 71,922,256 (GRCm39) missense probably benign 0.22
R5428:Aipl1 UTSW 11 71,921,313 (GRCm39) missense probably benign 0.02
R5933:Aipl1 UTSW 11 71,921,108 (GRCm39) missense probably benign 0.01
R8151:Aipl1 UTSW 11 71,927,584 (GRCm39) missense probably benign 0.44
R8379:Aipl1 UTSW 11 71,920,126 (GRCm39) missense probably benign 0.05
R8406:Aipl1 UTSW 11 71,922,332 (GRCm39) missense possibly damaging 0.87
R8998:Aipl1 UTSW 11 71,921,083 (GRCm39) missense possibly damaging 0.93
R8999:Aipl1 UTSW 11 71,921,083 (GRCm39) missense possibly damaging 0.93
R9340:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9346:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9422:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9424:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9462:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9576:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9577:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9578:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9593:Aipl1 UTSW 11 71,921,161 (GRCm39) missense probably benign
X0018:Aipl1 UTSW 11 71,921,367 (GRCm39) missense probably benign 0.00
Z1176:Aipl1 UTSW 11 71,921,359 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTGCAACAGTTCAATCAGGAAGAC -3'
(R):5'- CCACAAGGCTCTAACGAGTC -3'

Sequencing Primer
(F):5'- TTCAATCAGGAAGACAAGAGGCTG -3'
(R):5'- AGACAGGCCTGAATCTTGTC -3'
Posted On 2015-04-29