Incidental Mutation 'R4207:Spns3'
ID318981
Institutional Source Beutler Lab
Gene Symbol Spns3
Ensembl Gene ENSMUSG00000020798
Gene Namespinster homolog 3
Synonyms9830002I17Rik
MMRRC Submission 041036-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4207 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72494919-72550506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72538361 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 199 (V199E)
Ref Sequence ENSEMBL: ENSMUSP00000090617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021154] [ENSMUST00000092940]
Predicted Effect probably damaging
Transcript: ENSMUST00000021154
AA Change: V177E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021154
Gene: ENSMUSG00000020798
AA Change: V177E

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MFS_1 47 402 2.4e-28 PFAM
Pfam:Sugar_tr 48 225 3.3e-9 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092940
AA Change: V199E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090617
Gene: ENSMUSG00000020798
AA Change: V199E

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:Sugar_tr 44 248 1.5e-11 PFAM
Pfam:OATP 50 388 4.8e-9 PFAM
Pfam:MFS_1 55 425 4.2e-35 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Acap2 T A 16: 31,119,427 N293I probably damaging Het
Adgrg4 G A X: 56,918,749 V1893I possibly damaging Het
Aff1 T C 5: 103,818,988 probably null Het
Ap1b1 A G 11: 5,031,637 D515G probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Cand1 T C 10: 119,211,845 D580G probably damaging Het
Casp4 A G 9: 5,328,451 D311G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,827 V1033F probably damaging Het
Dhx29 G T 13: 112,927,949 A53S probably benign Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Efl1 T C 7: 82,750,816 V592A probably damaging Het
Elovl7 A T 13: 108,282,506 Q224L possibly damaging Het
Fcgr3 T A 1: 171,054,075 K160N probably benign Het
Flg A G 3: 93,279,862 Y207C probably benign Het
Fmn2 A G 1: 174,581,955 T585A unknown Het
Gm7135 T C 1: 97,469,895 noncoding transcript Het
Gm8104 G T 14: 43,101,634 D94Y probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kbtbd4 T C 2: 90,909,755 F495L probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Mthfsd A G 8: 121,105,626 V133A probably damaging Het
Nav2 T A 7: 49,572,298 probably null Het
Nav2 T A 7: 49,597,231 I2168N probably damaging Het
Nlrp10 T A 7: 108,924,341 D644V possibly damaging Het
Olfr1472 T C 19: 13,454,471 I15M probably benign Het
Olfr148 A G 9: 39,613,957 Y130C possibly damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Oplah C T 15: 76,302,710 R635H probably damaging Het
Peli1 A G 11: 21,147,115 probably null Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Pld5 T G 1: 175,993,875 T242P probably damaging Het
Rbm5 A G 9: 107,750,483 S420P probably benign Het
Rhag A T 17: 40,831,653 I250F probably damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Scaf4 C T 16: 90,260,215 V83I unknown Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Slc5a8 G T 10: 88,911,413 L409F probably damaging Het
Sspo A G 6: 48,478,293 T3030A probably benign Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Stk39 G T 2: 68,220,920 T527K probably benign Het
Sult2a1 T A 7: 13,801,547 T194S probably benign Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Umodl1 G A 17: 30,959,367 V106I probably damaging Het
Vmn2r85 A C 10: 130,418,705 C703W probably damaging Het
Vmn2r92 G A 17: 18,184,261 V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 I2322V probably benign Het
Zfp644 T C 5: 106,618,276 E93G probably damaging Het
Zfp81 C T 17: 33,334,916 C308Y probably damaging Het
Other mutations in Spns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Spns3 APN 11 72499353 critical splice donor site probably null
IGL02731:Spns3 APN 11 72529577 missense probably damaging 1.00
IGL03400:Spns3 APN 11 72499675 missense possibly damaging 0.65
R0948:Spns3 UTSW 11 72545940 missense probably damaging 1.00
R1807:Spns3 UTSW 11 72538340 nonsense probably null
R2151:Spns3 UTSW 11 72545961 splice site probably benign
R2393:Spns3 UTSW 11 72550233 start gained probably benign
R3703:Spns3 UTSW 11 72499530 splice site probably benign
R4685:Spns3 UTSW 11 72537270 missense probably damaging 1.00
R4932:Spns3 UTSW 11 72499495 missense possibly damaging 0.47
R5009:Spns3 UTSW 11 72537201 missense probably damaging 1.00
R5041:Spns3 UTSW 11 72536547 missense possibly damaging 0.46
R5997:Spns3 UTSW 11 72539078 missense probably damaging 1.00
R6179:Spns3 UTSW 11 72499523 missense probably damaging 1.00
R6277:Spns3 UTSW 11 72529640 missense possibly damaging 0.75
X0017:Spns3 UTSW 11 72505065 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGGCTAGCCTGGAATTTTCTC -3'
(R):5'- GCACAAAACTTAACCTTTCTTGGGG -3'

Sequencing Primer
(F):5'- CAGAGCAGTTGGAATTTGACCTC -3'
(R):5'- GAATGGGCTCAGAGGCTGC -3'
Posted On2015-06-10