Incidental Mutation 'R4905:Cdca7'
List |< first << previous [record 73 of 585] next >> last >|
ID378083
Institutional Source Beutler Lab
Gene Symbol Cdca7
Ensembl Gene ENSMUSG00000055612
Gene Namecell division cycle associated 7
Synonyms2310021G01Rik, JPO1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R4905 (G1)
Quality Score121
Status Not validated
Chromosome2
Chromosomal Location72476159-72486893 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA to TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA at 72481861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102691] [ENSMUST00000157019]
Predicted Effect probably benign
Transcript: ENSMUST00000102691
SMART Domains Protein: ENSMUSP00000099752
Gene: ENSMUSG00000055612

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 83 116 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
Pfam:zf-4CXXC_R1 273 371 1.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137880
Predicted Effect probably benign
Transcript: ENSMUST00000157019
SMART Domains Protein: ENSMUSP00000121263
Gene: ENSMUSG00000055612

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 118 151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a c-Myc responsive gene, and behaves as a direct c-Myc target gene. Overexpression of this gene is found to enhance the transformation of lymphoblastoid cells, and it complements a transformation-defective Myc Box II mutant, suggesting its involvement in c-Myc-mediated cell transformation. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Cdca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Cdca7 APN 2 72484644 missense probably damaging 1.00
R0600:Cdca7 UTSW 2 72483467 missense possibly damaging 0.49
R2265:Cdca7 UTSW 2 72482490 missense probably benign 0.01
R3413:Cdca7 UTSW 2 72485287 missense probably damaging 1.00
R3735:Cdca7 UTSW 2 72483865 splice site probably null
R4523:Cdca7 UTSW 2 72479698 missense probably damaging 1.00
R4627:Cdca7 UTSW 2 72481861 small deletion probably benign
R5044:Cdca7 UTSW 2 72483415 missense probably benign
R5156:Cdca7 UTSW 2 72479026 missense probably damaging 1.00
R5330:Cdca7 UTSW 2 72484698 missense probably damaging 1.00
R5372:Cdca7 UTSW 2 72482449 missense probably damaging 1.00
R5875:Cdca7 UTSW 2 72483557 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAAGGATTTTGTGGTGCCAC -3'
(R):5'- CCACAGCTTACAAACAGTTCTTAGG -3'

Sequencing Primer
(F):5'- TGGTTAACTAGAGACTGCAGTTGAAC -3'
(R):5'- GCTTACAAACAGTTCTTAGGAGAGAG -3'
Posted On2016-04-15