Incidental Mutation 'IGL02835:Agr2'
ID 391992
Institutional Source Beutler Lab
Gene Symbol Agr2
Ensembl Gene ENSMUSG00000020581
Gene Name anterior gradient 2
Synonyms mAG-2, HAG-2, XAG-2, Gob-4
Accession Numbers
Essential gene? Possibly essential (E-score: 0.504) question?
Stock # IGL02835 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 36042924-36054080 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36045903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000020898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020898]
AlphaFold O88312
Predicted Effect probably benign
Transcript: ENSMUST00000020898
AA Change: D50G

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581
AA Change: D50G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin_7 53 133 1.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147861
Meta Mutation Damage Score 0.2284 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,937,284 (GRCm39) K208* probably null Het
A530016L24Rik A C 12: 112,461,420 (GRCm39) probably null Het
A830018L16Rik A C 1: 12,042,279 (GRCm39) D433A possibly damaging Het
Abca13 T A 11: 9,401,515 (GRCm39) I3985N probably damaging Het
Abhd17c C T 7: 83,800,731 (GRCm39) D108N probably benign Het
Adam29 C T 8: 56,326,173 (GRCm39) D94N probably damaging Het
Angptl1 A G 1: 156,686,090 (GRCm39) D392G probably benign Het
Apob A G 12: 8,065,097 (GRCm39) N3989S possibly damaging Het
AU018091 T C 7: 3,218,897 (GRCm39) D12G unknown Het
Cyfip2 A T 11: 46,140,598 (GRCm39) S742T probably benign Het
Dlc1 C T 8: 37,051,055 (GRCm39) S892N probably damaging Het
Dsg1b A G 18: 20,525,071 (GRCm39) N169S possibly damaging Het
Egfem1 T C 3: 29,711,390 (GRCm39) L323P probably damaging Het
Emilin3 G A 2: 160,750,649 (GRCm39) Q320* probably null Het
Fjx1 G A 2: 102,281,092 (GRCm39) A281V possibly damaging Het
Fmn2 T A 1: 174,409,625 (GRCm39) D619E unknown Het
Gm4795 A C 10: 44,882,254 (GRCm39) noncoding transcript Het
Gm5117 T C 8: 32,227,198 (GRCm39) noncoding transcript Het
Gm5250 T C 1: 13,132,418 (GRCm39) noncoding transcript Het
Gtdc1 A T 2: 44,646,324 (GRCm39) Y101* probably null Het
Herc6 T C 6: 57,623,146 (GRCm39) I583T possibly damaging Het
Hyal4 G A 6: 24,765,714 (GRCm39) R356H probably benign Het
Il22ra2 C A 10: 19,502,424 (GRCm39) T81K probably benign Het
Iqcm T A 8: 76,281,511 (GRCm39) probably benign Het
Izumo4 G A 10: 80,540,959 (GRCm39) V220I probably benign Het
Kif16b A T 2: 142,554,133 (GRCm39) D899E probably benign Het
Lrp2 A T 2: 69,335,648 (GRCm39) N1358K probably damaging Het
Lrrk2 A G 15: 91,698,863 (GRCm39) probably null Het
Lyst C T 13: 13,835,685 (GRCm39) T1789M possibly damaging Het
Map4k4 A G 1: 40,049,760 (GRCm39) T732A probably damaging Het
Mdh1b A T 1: 63,757,816 (GRCm39) I305N probably damaging Het
Mettl13 A G 1: 162,373,585 (GRCm39) I222T probably damaging Het
Mtcl2 G A 2: 156,883,854 (GRCm39) T363I possibly damaging Het
Muc4 T C 16: 32,584,319 (GRCm39) F2583L probably benign Het
Nbea C T 3: 55,625,290 (GRCm39) R2267Q possibly damaging Het
Ndfip1 T C 18: 38,589,144 (GRCm39) Y178H probably damaging Het
Nin A T 12: 70,103,512 (GRCm39) F243I probably damaging Het
Nlrp10 A T 7: 108,523,869 (GRCm39) I537K possibly damaging Het
Nup155 T C 15: 8,172,614 (GRCm39) Y867H probably damaging Het
Pakap C G 4: 57,883,044 (GRCm39) P837A probably damaging Het
Pik3r4 A C 9: 105,549,905 (GRCm39) I999L probably benign Het
Pitpnm3 G A 11: 71,952,292 (GRCm39) probably benign Het
Pkd1l2 G A 8: 117,792,484 (GRCm39) T436I probably benign Het
Polg2 A T 11: 106,666,266 (GRCm39) V293E probably benign Het
Pramel22 T A 4: 143,380,817 (GRCm39) Y402F probably damaging Het
Prok1 T C 3: 107,144,531 (GRCm39) probably null Het
Ptcd1 T C 5: 145,091,500 (GRCm39) D533G possibly damaging Het
Ptpn13 T C 5: 103,707,891 (GRCm39) V1484A probably damaging Het
Rapgef2 A T 3: 79,000,293 (GRCm39) probably benign Het
Serpinb8 T G 1: 107,530,586 (GRCm39) F121L probably damaging Het
Sh3rf1 T A 8: 61,679,081 (GRCm39) V41E probably damaging Het
Snx13 A G 12: 35,182,126 (GRCm39) N725S possibly damaging Het
Stab1 A T 14: 30,867,981 (GRCm39) probably null Het
Themis A T 10: 28,637,616 (GRCm39) probably benign Het
Trim68 T A 7: 102,327,780 (GRCm39) Y391F probably benign Het
Trmt1 T G 8: 85,423,589 (GRCm39) V327G probably null Het
Vill C T 9: 118,896,513 (GRCm39) T120M probably benign Het
Other mutations in Agr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Agr2 APN 12 36,045,580 (GRCm39) missense possibly damaging 0.63
IGL02081:Agr2 APN 12 36,045,655 (GRCm39) critical splice donor site probably null
IGL03190:Agr2 APN 12 36,048,634 (GRCm39) missense probably damaging 1.00
R5514:Agr2 UTSW 12 36,046,090 (GRCm39) missense probably benign
R5894:Agr2 UTSW 12 36,045,509 (GRCm39) splice site probably benign
R6196:Agr2 UTSW 12 36,045,591 (GRCm39) nonsense probably null
R6584:Agr2 UTSW 12 36,045,625 (GRCm39) missense probably benign
R6585:Agr2 UTSW 12 36,045,625 (GRCm39) missense probably benign
R6850:Agr2 UTSW 12 36,045,558 (GRCm39) missense probably benign
R7384:Agr2 UTSW 12 36,045,923 (GRCm39) missense probably damaging 0.98
R7459:Agr2 UTSW 12 36,047,452 (GRCm39) missense probably benign 0.20
R7533:Agr2 UTSW 12 36,046,128 (GRCm39) critical splice donor site probably null
R7567:Agr2 UTSW 12 36,045,946 (GRCm39) missense probably benign 0.00
R8039:Agr2 UTSW 12 36,045,558 (GRCm39) missense probably benign 0.10
R8118:Agr2 UTSW 12 36,046,106 (GRCm39) missense probably benign 0.45
R9026:Agr2 UTSW 12 36,046,091 (GRCm39) missense probably benign 0.03
R9031:Agr2 UTSW 12 36,045,565 (GRCm39) missense probably benign
R9063:Agr2 UTSW 12 36,053,898 (GRCm39) makesense probably null
R9259:Agr2 UTSW 12 36,053,863 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCTGACTCTTGGTGTCG -3'
(R):5'- GTCCAAGTGATGAATGACCATC -3'

Sequencing Primer
(F):5'- CGTGTGTGCTATTAAGATATTTGGG -3'
(R):5'- ACCATCAAGGGTCTGTTGC -3'
Posted On 2016-06-08