Incidental Mutation 'R5272:Ddx55'
ID400402
Institutional Source Beutler Lab
Gene Symbol Ddx55
Ensembl Gene ENSMUSG00000029389
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Synonyms2810021H22Rik
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124552864-124569660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124558029 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 137 (I137F)
Ref Sequence ENSEMBL: ENSMUSP00000070279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071057] [ENSMUST00000111438] [ENSMUST00000131631]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071057
AA Change: I137F

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070279
Gene: ENSMUSG00000029389
AA Change: I137F

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 402 465 1.44e-26 SMART
low complexity region 491 506 N/A INTRINSIC
low complexity region 517 540 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111438
AA Change: I137F

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107065
Gene: ENSMUSG00000029389
AA Change: I137F

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 398 461 1.44e-26 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131631
SMART Domains Protein: ENSMUSP00000143462
Gene: ENSMUSG00000029389

DomainStartEndE-ValueType
Pfam:DEAD 33 125 6.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196021
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of protein family containing a characteristic Asp-Glu-Ala-Asp (DEAD) motif. These proteins are putative RNA helicases, and may be involved in a range of nuclear processes including translational initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Multiple alternatively spliced transcript variants have been found for this gene. Pseudogenes have been identified on chromosomes 1 and 12. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Tgif1 A G 17: 70,846,254 L34P probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Ddx55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Ddx55 APN 5 124567895 missense probably damaging 1.00
IGL03356:Ddx55 APN 5 124554753 missense possibly damaging 0.95
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0329:Ddx55 UTSW 5 124559147 missense probably benign 0.00
R0401:Ddx55 UTSW 5 124567951 missense probably damaging 1.00
R1604:Ddx55 UTSW 5 124559306 missense probably damaging 1.00
R1760:Ddx55 UTSW 5 124568113 missense probably damaging 0.99
R2002:Ddx55 UTSW 5 124566440 missense probably damaging 1.00
R2292:Ddx55 UTSW 5 124568077 missense probably benign 0.00
R4677:Ddx55 UTSW 5 124567934 missense probably benign 0.04
R4735:Ddx55 UTSW 5 124566476 missense probably damaging 1.00
R4745:Ddx55 UTSW 5 124566965 nonsense probably null
R4941:Ddx55 UTSW 5 124568716 nonsense probably null
R5348:Ddx55 UTSW 5 124554565 missense probably damaging 0.96
R5514:Ddx55 UTSW 5 124556812 missense probably damaging 1.00
R5801:Ddx55 UTSW 5 124566497 critical splice donor site probably null
R5806:Ddx55 UTSW 5 124559199 missense probably damaging 1.00
R5869:Ddx55 UTSW 5 124568682 missense probably benign
R5909:Ddx55 UTSW 5 124566850 missense probably benign 0.00
R6594:Ddx55 UTSW 5 124566925 missense probably damaging 1.00
R6737:Ddx55 UTSW 5 124552945 missense probably damaging 1.00
R7257:Ddx55 UTSW 5 124560721 missense possibly damaging 0.67
R7262:Ddx55 UTSW 5 124566856 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGTCCTGGCCTGTAATC -3'
(R):5'- AGTCCTTAGGTGTGAGGCAAC -3'

Sequencing Primer
(F):5'- GAGTCCTGGCCTGTAATCCTGTC -3'
(R):5'- CCAGGCTCACCCAACTCTGTG -3'
Posted On2016-07-06