Incidental Mutation 'R6128:Daw1'
ID487479
Institutional Source Beutler Lab
Gene Symbol Daw1
Ensembl Gene ENSMUSG00000053161
Gene Namedynein assembly factor with WDR repeat domains 1
Synonymsb2b1116Clo, 4930563E19Rik, 4933429D11Rik, Wdr69
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R6128 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location83159752-83210574 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 83205926 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 232 (C232*)
Ref Sequence ENSEMBL: ENSMUSP00000109063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065403] [ENSMUST00000065436] [ENSMUST00000113436] [ENSMUST00000149342]
Predicted Effect probably null
Transcript: ENSMUST00000065403
AA Change: C337*
SMART Domains Protein: ENSMUSP00000067583
Gene: ENSMUSG00000053161
AA Change: C337*

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 123 163 1.14e-8 SMART
WD40 166 205 1.95e-11 SMART
WD40 208 247 3.47e-8 SMART
WD40 250 289 2.98e-7 SMART
WD40 292 331 1.51e-8 SMART
WD40 334 373 4.87e-12 SMART
WD40 376 415 5.14e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065436
AA Change: C232*
SMART Domains Protein: ENSMUSP00000067102
Gene: ENSMUSG00000053161
AA Change: C232*

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 145 184 3.37e-6 SMART
WD40 187 226 1.51e-8 SMART
WD40 229 268 4.87e-12 SMART
WD40 271 310 5.14e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113436
AA Change: C232*
SMART Domains Protein: ENSMUSP00000109063
Gene: ENSMUSG00000053161
AA Change: C232*

DomainStartEndE-ValueType
WD40 81 120 1.17e-5 SMART
WD40 145 184 3.37e-6 SMART
WD40 187 226 1.51e-8 SMART
WD40 229 268 4.87e-12 SMART
WD40 271 317 7.99e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149342
SMART Domains Protein: ENSMUSP00000117796
Gene: ENSMUSG00000053161

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an induced mutation exhibit dextrocardia associated with situs inversus totalis, overriding aorta, ventricular septal defects, and dual inferior vena cava as well as dextrogastria, hypoplastic spleen, inverted liver, lung lobation/isomerism and dyskinetic/immotile airway cilia [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 S142P possibly damaging Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Kalrn T A 16: 34,212,885 Q469L probably damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pick1 T A 15: 79,239,696 M89K probably damaging Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Scamp1 A C 13: 94,208,227 L202R possibly damaging Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Ticrr C A 7: 79,693,968 P1194T probably damaging Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Daw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Daw1 APN 1 83197236 missense probably damaging 1.00
IGL00717:Daw1 APN 1 83198179 missense probably benign 0.03
IGL01320:Daw1 APN 1 83198180 missense possibly damaging 0.82
IGL01869:Daw1 APN 1 83182244 splice site probably benign
IGL02404:Daw1 APN 1 83197231 missense probably benign 0.15
IGL02516:Daw1 APN 1 83209228 missense probably benign 0.03
IGL02608:Daw1 APN 1 83209334 nonsense probably null
IGL02992:Daw1 APN 1 83197213 splice site probably benign
IGL03015:Daw1 APN 1 83183382 splice site probably benign
IGL03099:Daw1 APN 1 83179367 critical splice donor site probably null
R0050:Daw1 UTSW 1 83180365 missense probably benign 0.01
R0631:Daw1 UTSW 1 83197260 missense probably damaging 1.00
R0711:Daw1 UTSW 1 83191338 splice site probably benign
R1420:Daw1 UTSW 1 83159827 missense possibly damaging 0.51
R1678:Daw1 UTSW 1 83183366 missense probably damaging 1.00
R1943:Daw1 UTSW 1 83209266 missense possibly damaging 0.91
R2006:Daw1 UTSW 1 83191345 missense probably damaging 1.00
R2191:Daw1 UTSW 1 83192663 missense probably benign 0.34
R4983:Daw1 UTSW 1 83187998 missense probably benign 0.38
R5129:Daw1 UTSW 1 83205903 missense probably damaging 0.99
R5282:Daw1 UTSW 1 83192698 missense probably benign
Z1088:Daw1 UTSW 1 83205964 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGCCCATGATCTCTTC -3'
(R):5'- GCCTGACCCATATTAATATGTTGG -3'

Sequencing Primer
(F):5'- GATAGCAAGTCATGTCCAGCCTC -3'
(R):5'- ATGTTGGATATTTTGAAGGTACACTG -3'
Posted On2017-10-10