Incidental Mutation 'R6307:Rtkn2'
ID509485
Institutional Source Beutler Lab
Gene Symbol Rtkn2
Ensembl Gene ENSMUSG00000037846
Gene Namerhotekin 2
SynonymsPlekhk1, B130039D23Rik, RTKN2, Mbf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6307 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location67979570-68059740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68035832 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 350 (H350L)
Ref Sequence ENSEMBL: ENSMUSP00000112946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068994] [ENSMUST00000105437] [ENSMUST00000117086] [ENSMUST00000118160] [ENSMUST00000147556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068994
AA Change: H350L

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070717
Gene: ENSMUSG00000037846
AA Change: H350L

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 93 243 4.9e-37 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105437
AA Change: H348L

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101077
Gene: ENSMUSG00000037846
AA Change: H348L

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 241 3.1e-37 PFAM
PH 280 387 1.11e-6 SMART
low complexity region 527 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117086
AA Change: H347L

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112419
Gene: ENSMUSG00000037846
AA Change: H347L

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118160
AA Change: H350L

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112946
Gene: ENSMUSG00000037846
AA Change: H350L

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 94 242 1.4e-49 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147556
AA Change: H347L

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116166
Gene: ENSMUSG00000037846
AA Change: H347L

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc16 T C 9: 18,647,588 T2470A unknown Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably null Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Prr14l T A 5: 32,827,525 H1542L probably damaging Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Scara3 T C 14: 65,938,261 D19G probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Sema6a C A 18: 47,249,164 R772L probably damaging Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tmppe T C 9: 114,404,744 L37P probably benign Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Rtkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rtkn2 APN 10 68041664 missense probably benign 0.00
IGL01338:Rtkn2 APN 10 68025519 missense possibly damaging 0.83
IGL01865:Rtkn2 APN 10 68035875 missense probably benign 0.44
IGL03074:Rtkn2 APN 10 68041721 missense probably damaging 0.99
IGL03383:Rtkn2 APN 10 68017837 missense probably damaging 1.00
PIT4520001:Rtkn2 UTSW 10 67987461 missense probably damaging 1.00
R1167:Rtkn2 UTSW 10 67997620 missense probably damaging 1.00
R2166:Rtkn2 UTSW 10 68041696 missense possibly damaging 0.55
R2323:Rtkn2 UTSW 10 68001934 missense probably damaging 1.00
R3826:Rtkn2 UTSW 10 67997626 splice site probably null
R3827:Rtkn2 UTSW 10 67997626 splice site probably null
R3828:Rtkn2 UTSW 10 67997626 splice site probably null
R3829:Rtkn2 UTSW 10 67997626 splice site probably null
R4742:Rtkn2 UTSW 10 68003314 missense possibly damaging 0.72
R4867:Rtkn2 UTSW 10 68001927 missense probably damaging 0.99
R4871:Rtkn2 UTSW 10 68005633 missense probably damaging 1.00
R4936:Rtkn2 UTSW 10 68041915 makesense probably null
R5009:Rtkn2 UTSW 10 68041409 missense probably benign 0.14
R5709:Rtkn2 UTSW 10 68001970 missense probably benign 0.31
R6295:Rtkn2 UTSW 10 67979699 start gained probably benign
R6751:Rtkn2 UTSW 10 68041453 missense probably benign 0.43
R6823:Rtkn2 UTSW 10 68026632 missense probably damaging 0.96
R7011:Rtkn2 UTSW 10 67979665 unclassified probably benign
R7369:Rtkn2 UTSW 10 68041429 missense probably damaging 0.96
R7403:Rtkn2 UTSW 10 68005636 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTACGTTTCAAAGCATCAACGG -3'
(R):5'- AAAAGGTTTGTGGTACGTGGCC -3'

Sequencing Primer
(F):5'- TCAACGGCAAGATTATACAGTTGGC -3'
(R):5'- CGTGGTTTTCAGGGAATTTAAAAGAG -3'
Posted On2018-04-02