Incidental Mutation 'R6886:Fam20b'
ID536929
Institutional Source Beutler Lab
Gene Symbol Fam20b
Ensembl Gene ENSMUSG00000033557
Gene Namefamily with sequence similarity 20, member B
SynonymsC530043G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6886 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156678532-156719086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156690511 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 238 (W238R)
Ref Sequence ENSEMBL: ENSMUSP00000112534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086153] [ENSMUST00000122424]
Predicted Effect probably damaging
Transcript: ENSMUST00000086153
AA Change: W238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083322
Gene: ENSMUSG00000033557
AA Change: W238R

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:Fam20C 188 399 3.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122424
AA Change: W238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112534
Gene: ENSMUSG00000033557
AA Change: W238R

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:DUF1193 187 402 2e-95 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with decreased embryo size, multisystem organ hypoplasia, and delayed skeleton, digestive system, eye, liver, and lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b A T 8: 22,028,690 M44K probably benign Het
Bad T C 19: 6,951,334 probably benign Het
Bbs12 A G 3: 37,319,241 D61G probably damaging Het
Bcr C T 10: 75,153,937 R722C probably damaging Het
Carf C A 1: 60,136,254 probably null Het
Ccdc181 A G 1: 164,280,096 E116G probably damaging Het
Celsr1 A G 15: 86,031,654 V706A probably benign Het
Col9a1 T A 1: 24,185,345 S203T unknown Het
Ctsl T C 13: 64,365,147 probably null Het
Exosc7 A T 9: 123,135,958 E277D probably benign Het
Fanci A T 7: 79,420,342 H430L possibly damaging Het
Fstl4 A G 11: 53,186,450 D678G probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Gm11569 T A 11: 99,798,421 probably benign Het
Gm13084 A G 4: 143,812,762 F54L probably benign Het
Igfn1 G A 1: 135,973,460 R306W probably damaging Het
Il6 C T 5: 30,018,203 probably benign Het
Khdc1c T C 1: 21,369,525 L100P possibly damaging Het
Kif18a G A 2: 109,296,663 R314H probably damaging Het
Kif26b A C 1: 178,874,138 K694T probably damaging Het
Kndc1 A G 7: 139,913,569 T484A probably benign Het
Lonrf1 T C 8: 36,229,037 probably null Het
Man1a2 C T 3: 100,656,071 G169D probably benign Het
Med6 G T 12: 81,591,385 D17E probably damaging Het
Neb T C 2: 52,220,224 K204R probably damaging Het
Nhlrc1 T A 13: 47,013,776 N335I possibly damaging Het
Nlrp12 T C 7: 3,240,683 M400V probably benign Het
Olfr1054 A T 2: 86,333,064 C97* probably null Het
Olfr866 G T 9: 20,027,132 H269N probably benign Het
Pkhd1 C T 1: 20,347,280 S2549N probably benign Het
Rab4b A C 7: 27,172,956 L145R probably damaging Het
Rad50 T C 11: 53,686,184 I526V probably benign Het
Rel T C 11: 23,744,304 H309R probably benign Het
Rnf2 G T 1: 151,473,266 N34K possibly damaging Het
Serpina3m G T 12: 104,389,127 V18F possibly damaging Het
Serpinb9c T C 13: 33,150,327 K244R probably benign Het
Setbp1 T A 18: 78,857,500 Y984F probably damaging Het
Slc12a5 T A 2: 164,982,905 M410K probably benign Het
Smarca4 C T 9: 21,658,831 A710V probably damaging Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Ssrp1 T A 2: 85,039,936 D101E probably benign Het
Tax1bp1 A T 6: 52,733,223 E162D probably benign Het
Tenm4 T A 7: 96,797,392 M823K possibly damaging Het
Tesk1 A G 4: 43,443,592 D53G possibly damaging Het
Tnrc6a T A 7: 123,187,445 S1577T probably benign Het
Tpr A G 1: 150,423,965 I1270V probably benign Het
Trp53bp2 T C 1: 182,429,043 probably null Het
Ube4a A T 9: 44,948,843 I307N probably damaging Het
Unc13b A G 4: 43,170,156 probably benign Het
Vmn2r3 T C 3: 64,259,506 K735E probably damaging Het
Vmn2r54 A G 7: 12,632,153 F285L probably benign Het
Vmn2r81 T G 10: 79,268,154 S204A possibly damaging Het
Washc1 A G 17: 66,119,066 D453G probably damaging Het
Zfp329 T A 7: 12,810,098 I500L probably benign Het
Zfp516 A G 18: 82,957,000 D441G probably benign Het
Zfp644 T C 5: 106,637,911 T257A possibly damaging Het
Other mutations in Fam20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Fam20b APN 1 156702465 missense probably benign 0.13
consequences UTSW 1 156690553 missense probably damaging 1.00
Head_over_heels UTSW 1 156690570 missense probably damaging 1.00
minuscule UTSW 1 156705740 missense probably damaging 1.00
squirt UTSW 1 156705729 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0389:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0443:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0518:Fam20b UTSW 1 156687456 missense possibly damaging 0.70
R1466:Fam20b UTSW 1 156686188 splice site probably benign
R1584:Fam20b UTSW 1 156686188 splice site probably benign
R2014:Fam20b UTSW 1 156705941 missense possibly damaging 0.92
R4085:Fam20b UTSW 1 156705875 missense probably benign 0.01
R4755:Fam20b UTSW 1 156687496 nonsense probably null
R5254:Fam20b UTSW 1 156705740 missense probably damaging 1.00
R5471:Fam20b UTSW 1 156705729 missense probably damaging 1.00
R6944:Fam20b UTSW 1 156687521 missense probably benign 0.02
R7013:Fam20b UTSW 1 156690565 missense probably damaging 1.00
R7205:Fam20b UTSW 1 156702398 critical splice donor site probably null
R7215:Fam20b UTSW 1 156690553 missense probably damaging 1.00
R7286:Fam20b UTSW 1 156681442 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CACCACTGCTGAAAACAGGG -3'
(R):5'- GTGTGAAATGGACTAACATCAGGTTTC -3'

Sequencing Primer
(F):5'- TGCCCTTGATCCACAAGT -3'
(R):5'- ATCAGGTTTCTAATTTTCATGGTGCC -3'
Posted On2018-10-18