Incidental Mutation 'R6902:3110070M22Rik'
List |< first << previous [record 15 of 1871] next >> last >|
ID538613
Institutional Source Beutler Lab
Gene Symbol 3110070M22Rik
Ensembl Gene ENSMUSG00000074635
Gene NameRIKEN cDNA 3110070M22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6902 (G1)
Quality Score157.009
Status Not validated
Chromosome13
Chromosomal Location119487261-119488383 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 119488144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026519] [ENSMUST00000099147] [ENSMUST00000099148] [ENSMUST00000176171] [ENSMUST00000223912] [ENSMUST00000224312] [ENSMUST00000225186] [ENSMUST00000225726]
Predicted Effect probably benign
Transcript: ENSMUST00000026519
SMART Domains Protein: ENSMUSP00000026519
Gene: ENSMUSG00000062822

DomainStartEndE-ValueType
Pfam:DUF4524 9 154 5e-61 PFAM
Pfam:DUF4520 451 542 8.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099147
SMART Domains Protein: ENSMUSP00000096751
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000099148
AA Change: G22A
SMART Domains Protein: ENSMUSP00000096752
Gene: ENSMUSG00000074635
AA Change: G22A

DomainStartEndE-ValueType
low complexity region 66 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176171
SMART Domains Protein: ENSMUSP00000135685
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223912
Predicted Effect probably benign
Transcript: ENSMUST00000224312
Predicted Effect probably benign
Transcript: ENSMUST00000225186
Predicted Effect probably benign
Transcript: ENSMUST00000225726
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abcc9 T A 6: 142,679,227 S481C probably damaging Het
Adgrl3 C A 5: 81,689,587 S773R probably damaging Het
Alkbh5 G A 11: 60,538,555 A45T probably benign Het
Ankrd6 C A 4: 32,806,419 Q576H probably damaging Het
Ankrd6 T A 4: 32,806,420 Q576L probably damaging Het
Carmil1 T C 13: 24,115,545 N332S possibly damaging Het
Cc2d2b A G 19: 40,816,289 Q1250R possibly damaging Het
Chd9 A C 8: 91,042,951 N2539T probably damaging Het
Clec4b2 C T 6: 123,201,028 Q101* probably null Het
Clstn2 A T 9: 97,469,822 F517I probably damaging Het
Cog2 A G 8: 124,546,691 K590E probably damaging Het
Coq9 G A 8: 94,850,552 E182K probably benign Het
Focad C T 4: 88,230,476 R477C unknown Het
Gja10 G T 4: 32,601,905 H160N probably damaging Het
Gm1673 G A 5: 33,983,579 probably benign Het
Gpr132 T A 12: 112,852,210 Y332F probably benign Het
Herc2 A G 7: 56,135,486 T1495A probably benign Het
Hivep3 T A 4: 120,095,995 S503T possibly damaging Het
Ifi44 A T 3: 151,745,899 I190N possibly damaging Het
Igf1r T A 7: 68,004,163 C150S probably damaging Het
Ighv1-42 T A 12: 114,937,535 N4Y possibly damaging Het
Klra9 T A 6: 130,179,040 I251F probably benign Het
Krt79 T C 15: 101,931,879 N294S probably benign Het
Lama2 T G 10: 26,981,629 T3075P probably damaging Het
Lrfn1 T G 7: 28,459,813 C386G probably benign Het
Lrp2 T C 2: 69,459,503 D3664G probably damaging Het
Mfsd3 T A 15: 76,703,149 M344K probably damaging Het
Mier2 C A 10: 79,540,839 probably benign Het
Mmp2 G A 8: 92,836,917 V340M probably damaging Het
Mrgprb3 T A 7: 48,643,699 I35F probably benign Het
Myo5b A T 18: 74,676,685 I613F possibly damaging Het
Olfr299 T A 7: 86,465,787 C125* probably null Het
Olfr585 A T 7: 103,098,355 I205F probably benign Het
Olfr867 A T 9: 20,055,374 L30M possibly damaging Het
Olfr948 C A 9: 39,319,019 L198F probably damaging Het
Pan2 A G 10: 128,315,637 T867A probably benign Het
Papolb T A 5: 142,528,151 H579L probably benign Het
Pcf11 C A 7: 92,658,299 G887V probably damaging Het
Pdzd8 A G 19: 59,301,397 S524P possibly damaging Het
Pole3 T C 4: 62,524,063 probably benign Het
Prdm14 C T 1: 13,122,421 V365I probably benign Het
Shank1 T A 7: 44,356,815 F1985L probably benign Het
Slc13a1 T C 6: 24,097,666 I421V possibly damaging Het
Slc2a6 C T 2: 27,023,160 V374M probably benign Het
Spata1 A T 3: 146,475,323 N293K possibly damaging Het
Stk40 T A 4: 126,137,812 D366E probably benign Het
Tas2r117 T C 6: 132,803,325 L142S probably damaging Het
Tcrg-V1 T C 13: 19,340,020 L2P probably benign Het
Tomm70a T C 16: 57,138,081 S266P probably damaging Het
Vipr2 A T 12: 116,139,199 T310S possibly damaging Het
Vti1a A T 19: 55,499,241 probably null Het
Zfp961 A G 8: 71,968,678 K345R probably damaging Het
Other mutations in 3110070M22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4052:3110070M22Rik UTSW 13 119488202 unclassified probably benign
R4630:3110070M22Rik UTSW 13 119488086 unclassified probably benign
R6413:3110070M22Rik UTSW 13 119488111 unclassified probably benign
R6452:3110070M22Rik UTSW 13 119488115 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCGATGTCCTGAGATCAGCC -3'
(R):5'- CTGAGAGGTTTCGAGTCCAC -3'

Sequencing Primer
(F):5'- TCCTGAGATCAGCCGCCTC -3'
(R):5'- AGGTTTCGAGTCCACCCTGAG -3'
Posted On2018-11-06