Mutagenetix > Incidental Mutation

Incidental Mutation 'R0040:Apcs'

64649

Institutional Source

Beutler Lab

Gene Symbol

Apcs

Ensembl Gene

ENSMUSG00000026542

Gene Name

amyloid P component, serum

Synonyms

Sap

MMRRC Submission

038334-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R0040 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

172721528-172722516 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 172722023 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 108 (Y108H)

Ref Sequence

ENSEMBL: ENSMUSP00000027824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027824]

AlphaFold

P12246

Predicted Effect

probably benign
Transcript: ENSMUST00000027824
AA Change: Y108H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027824
Gene: ENSMUSG00000026542
AA Change: Y108H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PTX	21	224	2.27e-132	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.6%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased antibody productions, increased autoimmune antibodies, reduced amyloidosis and glomerulonephrosis depending on strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahrr	G	A	13: 74,431,143 (GRCm39)		probably benign	Het
Antxr2	G	A	5: 98,086,284 (GRCm39)	T441I	possibly damaging	Het
Atad5	A	G	11: 79,988,840 (GRCm39)	T666A	probably benign	Het
Atcay	C	T	10: 81,046,353 (GRCm39)		probably null	Het
Bahcc1	A	G	11: 120,159,196 (GRCm39)	D141G	probably damaging	Het
Ceacam10	A	G	7: 24,477,689 (GRCm39)	Y68C	probably damaging	Het
Cfap54	T	A	10: 92,812,901 (GRCm39)	Q1344L	probably benign	Het
Cyb5r4	A	G	9: 86,948,795 (GRCm39)		probably null	Het
Cyp2b9	G	T	7: 25,872,899 (GRCm39)	S14I	possibly damaging	Het
Dusp12	A	G	1: 170,708,226 (GRCm39)	Y164H	probably damaging	Het
Eml2	T	C	7: 18,930,539 (GRCm39)	V373A	possibly damaging	Het
Fat1	A	G	8: 45,479,441 (GRCm39)	D2829G	probably damaging	Het
Fbxl13	T	C	5: 21,691,371 (GRCm39)	T671A	probably damaging	Het
Fbxo28	G	T	1: 182,153,805 (GRCm39)		probably benign	Het
Fbxo44	A	G	4: 148,243,152 (GRCm39)	L89P	probably damaging	Het
Fndc3b	T	A	3: 27,610,266 (GRCm39)		probably null	Het
Gm9955	G	T	18: 24,842,209 (GRCm39)		probably benign	Het
Gprc6a	T	A	10: 51,491,080 (GRCm39)	K819*	probably null	Het
Gxylt1	A	T	15: 93,152,436 (GRCm39)		probably benign	Het
Hspa12a	T	C	19: 58,788,056 (GRCm39)	T589A	probably benign	Het
Idh2	A	G	7: 79,747,570 (GRCm39)	S317P	probably damaging	Het
Ifi30	T	C	8: 71,216,421 (GRCm39)		probably null	Het
Ifna16	G	A	4: 88,594,867 (GRCm39)	A76V	probably benign	Het
Itpr2	C	T	6: 146,246,638 (GRCm39)	E1127K	probably damaging	Het
Kank4	A	G	4: 98,667,457 (GRCm39)	V330A	probably benign	Het
Kpna1	T	A	16: 35,843,611 (GRCm39)	D328E	probably damaging	Het
Krt71	T	A	15: 101,646,868 (GRCm39)	H280L	possibly damaging	Het
Lrrc37	G	A	11: 103,433,816 (GRCm39)	P942S	probably damaging	Het
Mapt	A	G	11: 104,196,224 (GRCm39)	M446V	probably damaging	Het
Med1	C	T	11: 98,057,081 (GRCm39)		probably null	Het
Mif	T	A	10: 75,695,614 (GRCm39)	H63L	probably damaging	Het
Mycbp2	A	G	14: 103,461,708 (GRCm39)	V1447A	probably benign	Het
Myo1b	A	T	1: 51,821,148 (GRCm39)	I451N	probably damaging	Het
Nme2	A	T	11: 93,842,756 (GRCm39)		probably null	Het
Nubp1	A	G	16: 10,238,981 (GRCm39)	T199A	probably damaging	Het
Nup210l	T	A	3: 90,089,212 (GRCm39)	V1165D	probably damaging	Het
Nup98	T	A	7: 101,841,241 (GRCm39)	T122S	probably damaging	Het
Or14a258	A	T	7: 86,035,715 (GRCm39)	L51Q	probably benign	Het
Or1n2	T	C	2: 36,797,470 (GRCm39)	F171L	probably damaging	Het
Or5j1	C	T	2: 86,879,548 (GRCm39)	E11K	probably damaging	Het
Or6c202	T	A	10: 128,996,608 (GRCm39)	I82L	probably benign	Het
Pard3b	A	T	1: 62,676,979 (GRCm39)	Y1170F	probably damaging	Het
Pear1	T	C	3: 87,661,665 (GRCm39)	D536G	probably damaging	Het
Phrf1	G	T	7: 140,823,770 (GRCm39)	R196L	probably damaging	Het
Plxna2	G	T	1: 194,326,204 (GRCm39)	R46L	probably benign	Het
Rbm39	G	A	2: 155,990,099 (GRCm39)	T496I	possibly damaging	Het
Rpl14	C	G	9: 120,401,167 (GRCm39)	F3L	possibly damaging	Het
Rtf2	G	A	2: 172,286,616 (GRCm39)	S40N	probably damaging	Het
Runx2	G	A	17: 44,919,141 (GRCm39)	S481L	possibly damaging	Het
Sh3rf1	T	A	8: 61,782,286 (GRCm39)	Y143N	possibly damaging	Het
Siglec15	G	A	18: 78,092,092 (GRCm39)		probably benign	Het
Slc4a8	T	A	15: 100,687,727 (GRCm39)	I288N	probably damaging	Het
Ttc38	C	A	15: 85,725,690 (GRCm39)	F184L	probably damaging	Het
Vmn1r28	T	C	6: 58,242,879 (GRCm39)	Y241H	probably damaging	Het
Vmn2r110	A	T	17: 20,816,346 (GRCm39)	V59D	probably benign	Het
Wdpcp	A	G	11: 21,661,638 (GRCm39)	I303M	probably damaging	Het
Zc3h12d	G	A	10: 7,743,678 (GRCm39)	A483T	probably benign	Het
Zfp106	C	A	2: 120,362,094 (GRCm39)	K1008N	probably damaging	Het
Zfp334	A	G	2: 165,223,492 (GRCm39)	Y184H	probably benign	Het
Zfp68	G	A	5: 138,606,041 (GRCm39)	T94I	probably benign	Het
Zkscan3	A	T	13: 21,579,090 (GRCm39)		probably null	Het

Other mutations in Apcs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01590:Apcs	APN	1	172,722,034 (GRCm39)	missense	probably damaging	0.97
R0040:Apcs	UTSW	1	172,722,023 (GRCm39)	missense	probably benign
R0865:Apcs	UTSW	1	172,721,782 (GRCm39)	missense	probably benign	0.30
R1691:Apcs	UTSW	1	172,722,160 (GRCm39)	missense	probably damaging	1.00
R2158:Apcs	UTSW	1	172,722,100 (GRCm39)	missense	probably damaging	1.00
R3411:Apcs	UTSW	1	172,722,130 (GRCm39)	missense	probably damaging	1.00
R3949:Apcs	UTSW	1	172,722,259 (GRCm39)	missense	probably damaging	1.00
R4636:Apcs	UTSW	1	172,721,989 (GRCm39)	missense	probably damaging	1.00
R6911:Apcs	UTSW	1	172,721,752 (GRCm39)	missense	probably benign	0.02
R7218:Apcs	UTSW	1	172,722,231 (GRCm39)	missense	possibly damaging	0.85
R8143:Apcs	UTSW	1	172,721,900 (GRCm39)	missense	probably damaging	1.00
R8287:Apcs	UTSW	1	172,721,814 (GRCm39)	missense	possibly damaging	0.66
R8867:Apcs	UTSW	1	172,722,004 (GRCm39)	missense	possibly damaging	0.94
R9005:Apcs	UTSW	1	172,721,776 (GRCm39)	missense	probably benign	0.41
R9132:Apcs	UTSW	1	172,722,061 (GRCm39)	missense	probably damaging	0.97
R9329:Apcs	UTSW	1	172,722,391 (GRCm39)	missense	probably benign	0.00
RF005:Apcs	UTSW	1	172,721,809 (GRCm39)	missense	probably damaging	1.00
RF024:Apcs	UTSW	1	172,721,809 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTGAATTCTGCTGCCTTGACC -3'
(R):5'- CTGTGTTTCCGAACCTACAGTGACC -3'

Sequencing Primer
(F):5'- AGGACTGTGACCTTTGAAACC -3'
(R):5'- GAACCTACAGTGACCTTTCCCG -3'

Posted On

2013-08-06