Incidental Mutation 'R0040:Apcs'
ID64649
Institutional Source Beutler Lab
Gene Symbol Apcs
Ensembl Gene ENSMUSG00000026542
Gene Nameserum amyloid P-component
SynonymsSap
MMRRC Submission 038334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0040 (G1)
Quality Score93
Status Validated
Chromosome1
Chromosomal Location172893961-172895041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172894456 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 108 (Y108H)
Ref Sequence ENSEMBL: ENSMUSP00000027824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027824]
Predicted Effect probably benign
Transcript: ENSMUST00000027824
AA Change: Y108H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027824
Gene: ENSMUSG00000026542
AA Change: Y108H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PTX 21 224 2.27e-132 SMART
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased antibody productions, increased autoimmune antibodies, reduced amyloidosis and glomerulonephrosis depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,283,024 probably benign Het
Antxr2 G A 5: 97,938,425 T441I possibly damaging Het
Atad5 A G 11: 80,098,014 T666A probably benign Het
Atcay C T 10: 81,210,519 probably null Het
Bahcc1 A G 11: 120,268,370 D141G probably damaging Het
Ceacam10 A G 7: 24,778,264 Y68C probably damaging Het
Cfap54 T A 10: 92,977,039 Q1344L probably benign Het
Cyb5r4 A G 9: 87,066,742 probably null Het
Cyp2b9 G T 7: 26,173,474 S14I possibly damaging Het
Dusp12 A G 1: 170,880,657 Y164H probably damaging Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fbxl13 T C 5: 21,486,373 T671A probably damaging Het
Fbxo28 G T 1: 182,326,240 probably benign Het
Fbxo44 A G 4: 148,158,695 L89P probably damaging Het
Fndc3b T A 3: 27,556,117 probably null Het
Gm884 G A 11: 103,542,990 P942S probably damaging Het
Gm9955 G T 18: 24,709,152 probably benign Het
Gprc6a T A 10: 51,614,984 K819* probably null Het
Gxylt1 A T 15: 93,254,555 probably benign Het
Hspa12a T C 19: 58,799,624 T589A probably benign Het
Idh2 A G 7: 80,097,822 S317P probably damaging Het
Ifi30 T C 8: 70,763,776 probably null Het
Ifna16 G A 4: 88,676,630 A76V probably benign Het
Itpr2 C T 6: 146,345,140 E1127K probably damaging Het
Kank4 A G 4: 98,779,220 V330A probably benign Het
Kpna1 T A 16: 36,023,241 D328E probably damaging Het
Krt71 T A 15: 101,738,433 H280L possibly damaging Het
Mapt A G 11: 104,305,398 M446V probably damaging Het
Med1 C T 11: 98,166,255 probably null Het
Mif T A 10: 75,859,780 H63L probably damaging Het
Mycbp2 A G 14: 103,224,272 V1447A probably benign Het
Myo1b A T 1: 51,781,989 I451N probably damaging Het
Nme2 A T 11: 93,951,930 probably null Het
Nubp1 A G 16: 10,421,117 T199A probably damaging Het
Nup210l T A 3: 90,181,905 V1165D probably damaging Het
Nup98 T A 7: 102,192,034 T122S probably damaging Het
Olfr1106 C T 2: 87,049,204 E11K probably damaging Het
Olfr304 A T 7: 86,386,507 L51Q probably benign Het
Olfr354 T C 2: 36,907,458 F171L probably damaging Het
Olfr771 T A 10: 129,160,739 I82L probably benign Het
Pard3b A T 1: 62,637,820 Y1170F probably damaging Het
Pear1 T C 3: 87,754,358 D536G probably damaging Het
Phrf1 G T 7: 141,243,857 R196L probably damaging Het
Plxna2 G T 1: 194,643,896 R46L probably benign Het
Rbm39 G A 2: 156,148,179 T496I possibly damaging Het
Rpl14 C G 9: 120,572,101 F3L possibly damaging Het
Rtf2 G A 2: 172,444,696 S40N probably damaging Het
Runx2 G A 17: 44,608,254 S481L possibly damaging Het
Sh3rf1 T A 8: 61,329,252 Y143N possibly damaging Het
Siglec15 G A 18: 78,048,877 probably benign Het
Slc4a8 T A 15: 100,789,846 I288N probably damaging Het
Ttc38 C A 15: 85,841,489 F184L probably damaging Het
Vmn1r28 T C 6: 58,265,894 Y241H probably damaging Het
Vmn2r110 A T 17: 20,596,084 V59D probably benign Het
Wdpcp A G 11: 21,711,638 I303M probably damaging Het
Zc3h12d G A 10: 7,867,914 A483T probably benign Het
Zfp106 C A 2: 120,531,613 K1008N probably damaging Het
Zfp334 A G 2: 165,381,572 Y184H probably benign Het
Zfp68 G A 5: 138,607,779 T94I probably benign Het
Zkscan3 A T 13: 21,394,920 probably null Het
Other mutations in Apcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Apcs APN 1 172894467 missense probably damaging 0.97
R0040:Apcs UTSW 1 172894456 missense probably benign
R0865:Apcs UTSW 1 172894215 missense probably benign 0.30
R1691:Apcs UTSW 1 172894593 missense probably damaging 1.00
R2158:Apcs UTSW 1 172894533 missense probably damaging 1.00
R3411:Apcs UTSW 1 172894563 missense probably damaging 1.00
R3949:Apcs UTSW 1 172894692 missense probably damaging 1.00
R4636:Apcs UTSW 1 172894422 missense probably damaging 1.00
R6911:Apcs UTSW 1 172894185 missense probably benign 0.02
R7218:Apcs UTSW 1 172894664 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAGTGAATTCTGCTGCCTTGACC -3'
(R):5'- CTGTGTTTCCGAACCTACAGTGACC -3'

Sequencing Primer
(F):5'- AGGACTGTGACCTTTGAAACC -3'
(R):5'- GAACCTACAGTGACCTTTCCCG -3'
Posted On2013-08-06