Incidental Mutation 'R0756:Tll2'
ID 69478
Institutional Source Beutler Lab
Gene Symbol Tll2
Ensembl Gene ENSMUSG00000025013
Gene Name tolloid-like 2
Synonyms
MMRRC Submission 038936-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.787) question?
Stock # R0756 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 41071192-41195274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41108667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 328 (R328C)
Ref Sequence ENSEMBL: ENSMUSP00000025986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]
AlphaFold Q9WVM6
Predicted Effect probably damaging
Transcript: ENSMUST00000025986
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: R328C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 348 460 7.69e-44 SMART
CUB 461 573 8.69e-52 SMART
EGF_CA 573 614 1.26e-11 SMART
CUB 617 729 3.99e-51 SMART
EGF_CA 729 769 5.92e-8 SMART
CUB 773 885 3.08e-43 SMART
CUB 886 1002 2.25e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169941
SMART Domains Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
ZnMc 152 294 1.15e-54 SMART
CUB 331 443 7.69e-44 SMART
CUB 444 556 8.69e-52 SMART
EGF_CA 556 597 1.26e-11 SMART
CUB 600 712 3.99e-51 SMART
EGF_CA 712 752 5.92e-8 SMART
CUB 756 868 3.08e-43 SMART
CUB 869 985 2.25e-36 SMART
Meta Mutation Damage Score 0.5467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Slc45a1 GTT GT 4: 150,727,054 (GRCm39) probably null Het
Speer4d G C 5: 15,824,274 (GRCm39) probably null Het
Other mutations in Tll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Tll2 APN 19 41,074,805 (GRCm39) missense probably benign 0.01
IGL02028:Tll2 APN 19 41,087,088 (GRCm39) nonsense probably null
IGL02146:Tll2 APN 19 41,086,276 (GRCm39) missense probably benign 0.00
IGL02192:Tll2 APN 19 41,074,702 (GRCm39) missense possibly damaging 0.73
IGL02544:Tll2 APN 19 41,124,404 (GRCm39) missense probably damaging 1.00
PIT4677001:Tll2 UTSW 19 41,118,997 (GRCm39) missense probably benign 0.14
R0141:Tll2 UTSW 19 41,086,351 (GRCm39) missense probably damaging 1.00
R0372:Tll2 UTSW 19 41,171,752 (GRCm39) critical splice acceptor site probably null
R0393:Tll2 UTSW 19 41,077,265 (GRCm39) missense possibly damaging 0.95
R0402:Tll2 UTSW 19 41,087,132 (GRCm39) missense possibly damaging 0.56
R0613:Tll2 UTSW 19 41,093,429 (GRCm39) missense probably damaging 0.97
R0757:Tll2 UTSW 19 41,108,667 (GRCm39) missense probably damaging 1.00
R0790:Tll2 UTSW 19 41,092,289 (GRCm39) missense probably damaging 0.98
R0834:Tll2 UTSW 19 41,101,512 (GRCm39) missense probably damaging 1.00
R0843:Tll2 UTSW 19 41,116,902 (GRCm39) splice site probably null
R1014:Tll2 UTSW 19 41,092,290 (GRCm39) missense probably damaging 1.00
R1178:Tll2 UTSW 19 41,081,286 (GRCm39) missense probably damaging 1.00
R1233:Tll2 UTSW 19 41,084,423 (GRCm39) missense possibly damaging 0.79
R1364:Tll2 UTSW 19 41,108,667 (GRCm39) missense probably damaging 1.00
R1367:Tll2 UTSW 19 41,108,667 (GRCm39) missense probably damaging 1.00
R1368:Tll2 UTSW 19 41,108,667 (GRCm39) missense probably damaging 1.00
R1519:Tll2 UTSW 19 41,074,839 (GRCm39) missense probably benign 0.17
R1894:Tll2 UTSW 19 41,077,110 (GRCm39) critical splice donor site probably null
R1896:Tll2 UTSW 19 41,101,498 (GRCm39) missense probably benign 0.44
R1917:Tll2 UTSW 19 41,116,936 (GRCm39) missense possibly damaging 0.83
R2170:Tll2 UTSW 19 41,171,714 (GRCm39) missense probably damaging 1.00
R4433:Tll2 UTSW 19 41,109,787 (GRCm39) missense probably benign 0.03
R4617:Tll2 UTSW 19 41,087,075 (GRCm39) missense probably benign 0.31
R4831:Tll2 UTSW 19 41,118,951 (GRCm39) missense probably damaging 1.00
R5057:Tll2 UTSW 19 41,105,705 (GRCm39) missense probably benign 0.02
R5119:Tll2 UTSW 19 41,118,948 (GRCm39) missense possibly damaging 0.48
R5194:Tll2 UTSW 19 41,084,336 (GRCm39) missense probably damaging 1.00
R5280:Tll2 UTSW 19 41,105,696 (GRCm39) missense possibly damaging 0.87
R5602:Tll2 UTSW 19 41,093,420 (GRCm39) missense possibly damaging 0.63
R5800:Tll2 UTSW 19 41,093,373 (GRCm39) missense probably benign 0.10
R6223:Tll2 UTSW 19 41,124,391 (GRCm39) missense possibly damaging 0.54
R7047:Tll2 UTSW 19 41,074,679 (GRCm39) missense probably damaging 0.99
R7155:Tll2 UTSW 19 41,105,723 (GRCm39) missense possibly damaging 0.72
R7213:Tll2 UTSW 19 41,108,666 (GRCm39) missense probably damaging 0.97
R7231:Tll2 UTSW 19 41,074,673 (GRCm39) missense probably benign 0.02
R7390:Tll2 UTSW 19 41,108,608 (GRCm39) critical splice donor site probably null
R7414:Tll2 UTSW 19 41,092,268 (GRCm39) missense probably damaging 0.98
R7757:Tll2 UTSW 19 41,084,447 (GRCm39) missense probably damaging 1.00
R8165:Tll2 UTSW 19 41,077,313 (GRCm39) missense possibly damaging 0.79
R8418:Tll2 UTSW 19 41,081,276 (GRCm39) missense probably damaging 1.00
R8788:Tll2 UTSW 19 41,109,814 (GRCm39) missense probably benign 0.00
R8811:Tll2 UTSW 19 41,195,012 (GRCm39) missense probably benign
R9227:Tll2 UTSW 19 41,093,436 (GRCm39) missense probably benign 0.34
R9230:Tll2 UTSW 19 41,093,436 (GRCm39) missense probably benign 0.34
R9280:Tll2 UTSW 19 41,077,309 (GRCm39) missense possibly damaging 0.83
R9282:Tll2 UTSW 19 41,074,772 (GRCm39) missense probably benign
R9382:Tll2 UTSW 19 41,116,997 (GRCm39) missense probably benign 0.04
R9715:Tll2 UTSW 19 41,092,238 (GRCm39) missense probably damaging 0.99
R9760:Tll2 UTSW 19 41,119,084 (GRCm39) missense probably damaging 1.00
R9801:Tll2 UTSW 19 41,194,993 (GRCm39) missense probably benign
X0027:Tll2 UTSW 19 41,171,742 (GRCm39) missense probably damaging 1.00
Z1177:Tll2 UTSW 19 41,081,173 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCATTAGGGAACCGTACCCCTATC -3'
(R):5'- GTCTCCTCACACATAGCTTGGCAG -3'

Sequencing Primer
(F):5'- CCACACTGTGCTGGATAATTGAG -3'
(R):5'- AGCCTTGACTTTtctccctctttc -3'
Posted On 2013-09-30