Allele | amontillado | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 58,883,929 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Casp8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | caspase 8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | MACH, Caspase-8, Mch5, FLICE | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 58,834,533-58,886,662 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013] PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_009812 (variant 1), NM_001080126 (variant 2), NM_001277926 (variant 3); MGI: 1261423 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Valine changed to Alanine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000027189] [ENSMUSP00000127375] [ENSMUSP00000140335] [ENSMUSP00000140546] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | O89110 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000027189 Gene: ENSMUSG00000026029 AA Change: V412A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000127375 Gene: ENSMUSG00000026029 AA Change: V412A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000140335 Gene: ENSMUSG00000026029 AA Change: V432A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000140546 Gene: ENSMUSG00000026029 AA Change: V432A
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9261 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Essential (E-score: 1.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(15) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(1) Targeted(11) Transgenic(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-02-13 12:18 PM by Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-04-22 8:34 AM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2017-02-02 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
Homozygosity for the amontillado mutation in Casp8 was associated with increased frequencies of effector memory CD8 T cells (Figure 1). CD8 T cells from the blood of homozygous mice exhibited increased CD44 expression, detected as increased in CD44 MFI after immunostaining (Figure 2). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire from pedigree R4236 identified 50 mutations. The phenotypes described above (Phenotypic Description) were linked by continuous variable mapping to a mutation in Casp8: a T to C transition at base pair 58,844,770 (GRCm38) on chromosome 1, or base pair 49,543 in the GenBank genomic region NC_000067 encoding caspase-8. The strongest linkage (P = 4.14 x 10-14) was to an elevated frequency of effector memory cells among CD8 T cells in the blood, found with a recessive model of inheritance, wherein 8 homozygous variant mice departed phenotypically from 32 heterozygous and 11 wild type mice (Figure 3). The mutation corresponds to residue 1,628 in the mRNA sequence NM_009812, within 8 of 9 exons.
The mutated nucleotide is indicated in red. The mutation results in a valine to alanine substitution at position 432 (V432A) in the caspase-8 protein (isoform 1). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Caspase-8 is one of 14 caspase proteins (cysteine-dependent aspartate-specific proteases) found in mice. These enzymes cleave protein substrates after Asp residues to propagate signaling leading to apoptosis (caspase-2, -3, -6, -7, -8, -9, -10) or inflammation (caspase-1, -4, -5, -8); capsases may also have roles in other processes such as differentiation (caspase-14) (1). The apoptotic caspases are classified as initiator (caspase-2, -8, -9, -10) or effector caspases (caspase-3, -6, -7), the effector caspases being activated by initiator caspases, whereas initiator caspases are activated by non-caspases through a mechanism involving clustering leading to dimerization. Caspases are initially produced as zymogens (procaspases). The structural organization of all procaspases is similar, consisting of an N-terminal prodomain and a C-terminal catalytic domain (Figure 4) (2). For initiator caspases including caspase-8, the prodomain contains motif(s) that bind homotypically to adapter proteins that have been recruited to an activated death receptor (3). In caspase-8, two tandem death effector domains (DEDs) contained within the prodomain mediate clustering at death receptor-adapter complexes to facilitate caspase dimerization critical for catalytic activation (4). DEDs fold into a six-helix bundle characteristic of the death domain fold superfamily (5).
The caspase catalytic domain is composed of two subunits (large, p20; and small, p10) covalently connected by the intersubunit linker. Autoproteolytic cleavage of the linker in caspase-8 occurs following dimerization, separating the large and small subunits of the catalytic domain; subsequently the prodomain is cleaved from the large subunit (6). Linker cleavage is insufficient for catalytic activation of caspase-8, and instead stabilizes the catalytic conformation induced by dimerization (7). Autoproteolytic cleavage of caspase-8 also switches its target specificity from itself to downstream effector caspases (6). Dimerization in the absence of linker cleavage results in a catalytically active form of caspase-8 capable of signaling T cell proliferation and activation, but not cell death, which requires cleaved caspase-8 (8); this finding supports the idea that the extent of cleavage modulates the function of caspase-8. In contrast, effector caspases exist as stable but inactive dimers, and proteolytic cleavage of the linker directly activates their catalytic activity (2). An important regulator of caspase-8 is a homologue called FLIPL (FLICE-like inhibitory protein, long form) (9), which can heterodimerize with and activate caspase-8 (10-12). FLIPL contains tandem DEDs at the N-terminus and a catalytically inactive protease-like domain at the C-terminus which can dimerize with the protease domain of caspase-8 (13). Heterodimerization enhances the proteolytic activity of caspase-8 by inducing an active conformation at the catalytic active site (13). Because FLIPL has DEDs, it can compete with caspase-8 for binding to the DISC and therefore also functions as a negative regulator of caspase-8 activation when expressed at high levels (14-16). Like other mature caspases, mature caspase-8 is a dimer arranged in a large:small:small:large subunit configuration and contains two active sites on opposite sides of the dimer (17;18). The crystal structure of the asymmetric unit containing one small and one large subunit is in the shape of a cylinder with a central six-stranded β-sheet surrounded by six α-helices (Figure 5). Substrate binding is mediated by five loops on the exterior surface of the dimer. N-terminal to the substrate cleavage site, a four amino acid recognition sequence consisting of (Leu/Val)-Glu-X-Asp (P4-P1) is preferred in vitro by caspases-6, -8, -9, and -10 (19). There is also a preference for small amino acids such as Ala, Gly, and Ser at the first position immediately C-terminal to the cleavage site (P1’) (20). However, analysis of natural substrates cleaved in apoptotic cells revealed a lack of specificity at the P4 site, suggesting more complex regulation in vivo (21). Mouse and human caspase-8 are 69.3% identical in amino acid sequence. The amontillado mutation is located in the small subunit of the catalytic domain, within loop 4 of the five loops that mediate substrate binding at the surface of caspase-8. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Northern blot analysis showed Casp8 expression in most adult mouse tissues including heart, brain, spleen, thymus, lung, liver, kidney, and testis (22). Relatively higher expression levels were detected in the spleen, thymus, lung, liver, and kidney than in heart, brain, and testis. In mouse embryos, Casp8 expression was about two-fold higher at E9.5 compared to E17.5 (22). Caspase-8 protein was detected in whole E8 mouse embryos, and in the thymus, spleen, kidney, stomach, heart, intestine, lung, skin, muscle, and liver of E17 embryos (23). No caspase-8 protein was found in the brain of E17 mouse embryos. The function of caspase-8 has been tested in several cell types in which it is expressed, including hematopoietic progenitor cells (24), myeloid cells (24), T cells (25), B cells (26), hepatocytes (24), and endothelial cells (24). Caspase-8 has been reported to localize in the cytoplasm (27;28), in the nucleus upon sumoylation (29-31), and in mitochondria or at the mitochondrial membrane (31;32); the mitochondrial localization has been disputed (33). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Role of caspase-8 in the extrinsic pathway of apoptosis Caspases are critical components of the signaling pathways leading to apoptosis, or programmed cell death. This physiological process is triggered by virus infection, toxic stress, environmental insults, hormones, and other stimuli (2). At least two pathways are well known to activate apoptosis: 1) The intrinsic pathway of apoptosis is activated from within the cell by mitochondrial damage, cytochrome c release, and formation of a complex called the apoptosome (Apaf-1, procaspase-9), which activates the initiator protease caspase -9 (34). 2) The extrinsic pathway is triggered by the engagement of death receptors such as CD95 (Fas) and TNFR1, cell surface transmembrane proteins containing an intracellular death domain (DD) and an extracellular cysteine-rich ligand binding domain (35). Ligand binding to death receptors results in receptor aggregation at the cell membrane and the subsequent clustering of downstream signaling complexes (36;37). In response to activation by Fas ligand (FasL), recruitment of the adapter FADD to the receptor occurs via DD-DD interactions; the DED of FADD then recruits caspase-8 or caspase-10 via DED-DED interactions (Figure 6). The ternary complex containing Fas, FADD, and caspase-8/10 is called the death-inducing signaling complex (DISC) (28;34;37-39), and activates caspase-8 by proximity-induced dimerization. Caspase-8 cleaves effector caspases (caspase-3 and caspase-7) that go on to degrade cellular organelles during the process of apoptosis. In some cells, the intrinsic apoptotic pathway is also triggered following Fas activation through a process in which caspase-8 cleaves BID, resulting in mitochondrial damage and cytochrome c release leading to apoptosis (40). Caspase-8 also participates in proapoptotic signaling induced by TRAIL receptors 1 and 2 [reviewed in (41)] and by TNFR1 (Figure 6) (42;43). Following activation of TNFR1 by TNF-α, ‘complex I’ containing the receptor, the adapter TRADD (TNFRSF1A-associated via death domain), RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1), TRAF2, and cellular inhibitor of apoptosis proteins cIAP1 and cIAP2 is formed at the cell membrane (42). Complex I recruits and activates the IKK complex leading to the activation of NF-κB (44-46). A second complex is subsequently formed in the cytoplasm (complex II) containing TRADD, RIPK1, FADD, and caspase-8; this complex contains FLIPL (acting as a caspase-8 inhibitor) when NF-κB has been activated by complex I, thereby permitting cell survival (42). When NF-κB, which positively regulates the expression of FLIPL (47;48), has not been activated by complex I, caspase-8 becomes activated in complex II, initiating the apoptotic cascade. Caspase-8 also negatively regulates necroptosis mediated by RIPK3 (see below). Another caspase-8 activation pathway induced by TNF-α is dependent on Diablo, a mitochondrial protein that binds cIAP1 and cIAP2, resulting in their degradation (43). The degradation of cIAP1/2 leads to the release of RIPK1 from the activated TNFR1 complex, promoting formation of a caspase-8-activating complex containing FADD, RIPK1, and caspase-8. The in vivo importance of caspase-8 in apoptosis has been confirmed using fibroblasts derived from caspase-8 knockout mouse embryos; these fibroblasts failed to undergo apoptosis when Fas, TNFR1, or TRAIL-R1 were stimulated (49).
Regulation of pro-IL-1β processing and inflammasome signaling by caspase-8 Although best known as an initiator caspase necessary for apoptosis triggered by death receptor activation, caspase-8 is also involved in IL-1 receptor-dependent inflammatory signaling by virtue of its role in the proteolytic processing of IL-1β to its mature form (Figure 7) [reviewed in (50)]. Caspase-8 has been implicated in directly cleaving pro-IL-1β. For example, direct cleavage of IL-1β by caspase-8 occurred in dendritic cells or macrophages upon activation of Toll-like receptor 3 (TLR3) or TLR4, either alone or in combination with another stimulus such as FasL or tunicamycin (an inducer of the ER stress response) (51-54). Caspase-8 has also been shown to cleave pro-IL-1β during infections with fungi and mycobacteria sensed by the receptor dectin-1, which induces a complex containing CARD9, BCL10, MALT1, ASC, and caspase-8 (55). In addition to directly processing pro-IL-1β, caspase-8 serves as an initiator caspase for the activation of caspase-1, which directly processes pro-IL-1β, in inflammasomes (56-59). Stimulation of the NLRP3 inflammasome by LPS plus either ATP or nigericin, or by C. rodentium infection, results in recruitment of caspase-8 to the inflammasome complex where caspase-8 cleaves and processes procaspase-1; deficiency of caspase-8 resulted in reduced IL-1β production (57). In contrast with these studies, others found that caspase-8 may negatively regulate NLRP3 inflammasome activation and IL-1β production (60;61). It has been proposed that the discrepancy in the reported function of caspase-8 in NLRP3 inflammasome regulation may be due to different stimulation conditions (LPS-induced spontaneous activation of NLRP3 inflammasomes versus LPS+ATP–induced activation of NLRP3 inflammasomes) (50). Effects of caspase-8 deficiency in vivo Caspase-8 deficiency in mice results in embryonic lethality at E10.5 (49). Importantly, knockout of RIPK3, upon which the necrotic cell death pathway depends, rescued Casp8-/- mice from embryonic death (62;63). This finding demonstrated that caspase-8 opposes RIPK3-mediated necroptosis during embryonic development (Figure 6). T cell-specific caspase-8 deficiency in mice (tcasp8-/-) resulted in defective T cell proliferation and homeostasis despite normal thymocyte development, leading to reduced peripheral T cells (25). The reduction in T cells is thought to stem from increased necroptosis upon activation because RIPK3 knockout restored normal T cell frequencies (62). T cell clonal expansion required caspase-8 catalytic activity, which was induced within 24 hours of TCR ligation but appeared to be distinct from death receptor-induced activity in that proteolytic cleavage of the intersubunit linker was unnecessary for T cell clonal expansion (64). tcasp8-/- T cells displayed impaired responses to activation stimuli, and showed activation marker upregulation and stimulation-independent proliferation of peripheral T cells (25;65). tcasp8-/- mice failed to mount a T cell-mediated immune response to LCMV infection (25). Moreover, they developed an age-dependent lethal lymphoproliferative disorder different from autoimmune lymphoproliferative syndrome (ALPS) characterized by lymphoadenopathy, splenomegaly, and accumulation of T cell infiltrates in the lungs, liver, and kidneys (65). These findings are consistent with a report of caspase-8 deficiency in humans caused by a point mutation (R248W) in the large subunit of the catalytic domain (66). Homozygous individuals exhibited lymphoadenopathy and splenomegaly, along with defective activation of T cells, B cells, and NK cells that resulted in immunodeficiency (66). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The amontillado mutation occurs within one of five loops at the surface of caspase-8 that recognize and bind substrates, and may therefore impair the interaction of caspase-8 with its substrates. However, unlike mice with a null mutation of Casp8 (49), homozygous amontillado mice are born alive and survive past weaning age, suggesting that the mutant caspase-8 protein produced in amontillado mice retains some function. The level of function, while sufficient to support embryonic development, was inadequate for normal T cell proliferation and homeostasis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer amontillado_pcr_F: AAAGTGCCCTTCCCTGTCTG amontillado_pcr_R: GCCAATGGCTACTTCTCTGCTTAG Sequencing Primer amontillado_seq_F: GCTTGCCAAGGAAGTAAC amontillado_seq_R: TCTGCTTAGTATATATTATCTCGGCC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation. PCR Primers amontillado_PCR_F: 5’- AAAGTGCCCTTCCCTGTCTG-3’ amontillado_PCR_R: 5’- GCCAATGGCTACTTCTCTGCTTAG-3’ Sequencing Primers amontillado_SEQ_F: 5’- GCTTGCCAAGGAAGTAAC-3’ amontillado_SEQ_R: 5’- TCTGCTTAGTATATATTATCTCGGCC-3’ PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C hold The following sequence of 400 nucleotides is amplified (Chr10: 9239383-61667422; NC_000067): 49321 tgacatctta cttcactggt tcaaagtgcc cttccctgtc tgggaaaccc aagatctttt 49381 tcattcaggc ttgccaagga agtaacttcc agaaaggagt gcctgatgag gcaggcttcg 49441 agcaacagaa ccacacttta gaagtggatt catcatctca caagaactat attccggatg 49501 aggcagactt tctgctggga atggctacgg tgaagaactg cgtttcctac cgagatcctg 49561 tgaatggaac ctggtatatt cagtcacttt gccagagcct gagggaaaga tgtcctcagt 49621 aagtttggcc tcctgggccc ctctcagggt tatgcttcct tactcatttc tgtggttaga 49681 gcccattaga aggtgcttta tggccgagat aatatatact aagcagagaa gtagccattg 49741 gc Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>C). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
41. Peter, M. E. (2000) The TRAIL DISCussion: It is FADD and Caspase-8! Cell Death Differ. 7, 759-760.
46. Wu, C. J., Conze, D. B., Li, T., Srinivasula, S. M., and Ashwell, J. D. (2006) Sensing of Lys 63-Linked Polyubiquitination by NEMO is a Key Event in NF-kappaB Activation [Corrected]. Nat Cell Biol. 8, 398-406.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Ming Zeng, Xue Zhong, Bruce Beutler |